SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g10241): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g10241): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g10241

Feature Type:gene_model
Chromosome:Gm08
Start:7405855
stop:7410998
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g10241
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G18360AT Annotation by Michelle Graham. TAIR10: Aldolase-type TIM barrel family protein | chr4:10146627-10148386 REVERSE LENGTH=314 SoyBaseE_val: 4.00E-81ISS
GO:0000041GO-bp Annotation by Michelle Graham. GO Biological Process: transition metal ion transport SoyBaseN/AISS
GO:0010204GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-independent SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0050665GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0008891GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolate oxidase activity SoyBaseN/AISS
GO:0010181GO-mf Annotation by Michelle Graham. GO Molecular Function: FMN binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
PTHR10578Panther (S)-2-HYDROXY-ACID OXIDASE-RELATED JGI ISS
PF01070PFAM FMN-dependent dehydrogenase JGI ISS
UniRef100_O49506-2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Isoform 2 of Peroxisomal (S)-2-hydroxy-acid oxidase GLO5 n=1 Tax=Arabidopsis thaliana RepID=O49506-2 SoyBaseE_val: 2.00E-78ISS
UniRef100_UPI0002337E26UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337E26 related cluster n=1 Tax=unknown RepID=UPI0002337E26 SoyBaseE_val: 8.00E-106ISS

Expression Patterns of Glyma08g10241
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g10241 not represented in the dataset
Glyma08g10241 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g10241 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma08g10241
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g10241
>Glyma08g10241.1   sequence type=CDS   gene model=Glyma08g10241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGATGGATATGATAACTAATGTTACCGAGTATGAGGCAATTGCAAAGGAAAATTTGCCAAAGATGGTTTATGACTTCTATGCATCAGGGGCAGAGGATCAGTGGACTTTGAAAGAGAACCGAAATGCATTCTCAAGGATTCTATTCCGGCTGCGTATTCTTGTTGATTTAAGCAAGATAGACTTGACTACAACTGTATTGGGCTTCAAAATATCAATGCCTATCATGATTGCTCCAACAGCCAAGCAAAAGATGGCTCACCCTGAAGGAGAATTAGATACTGCTAGAGCAGCATCAGCAGCTGGCACAATCATGACACTATCCTCAACTGCTACTTCCAGTGTCGAGGAGGTTGCTTCAACAGGTCCCGGCATTCATTTTTTCAACTTTATAACTCAGTGCTATATTGCCATGGCAATTGCCCTTACTGTGGACACTCCAGTTCTTGGTCGTAGGGAGGCTGACATCAAAAACAGGTTGGCAACCATTTGGAAATTTCAACCGGAACAGCCTTTCCACTTAACTTTACATGGTCCATCATGA
Predicted protein sequences of Glyma08g10241
>Glyma08g10241.1   sequence type=predicted peptide   gene model=Glyma08g10241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKMDMITNVTEYEAIAKENLPKMVYDFYASGAEDQWTLKENRNAFSRILFRLRILVDLSKIDLTTTVLGFKISMPIMIAPTAKQKMAHPEGELDTARAASAAGTIMTLSSTATSSVEEVASTGPGIHFFNFITQCYIAMAIALTVDTPVLGRREADIKNRLATIWKFQPEQPFHLTLHGPS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo