Glyma08g10230 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g10230

Feature Type:	gene_model
Chromosome:	Gm08
Start:	7397972
stop:	7402662
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g10230

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G18360	AT	Annotation by Michelle Graham. TAIR10: Aldolase-type TIM barrel family protein \| chr4:10146141-10148386 REVERSE LENGTH=368	SoyBase	E_val: 0	ISS
GO:0000041	GO-bp	Annotation by Michelle Graham. GO Biological Process: transition metal ion transport	SoyBase	N/A	ISS
GO:0010204	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-independent	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0050665	GO-bp	Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process	SoyBase	N/A	ISS
GO:0005777	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: peroxisome	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0008891	GO-mf	Annotation by Michelle Graham. GO Molecular Function: glycolate oxidase activity	SoyBase	N/A	ISS
GO:0010181	GO-mf	Annotation by Michelle Graham. GO Molecular Function: FMN binding	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
KOG0538	KOG	Glycolate oxidase	JGI		ISS
PTHR10578	Panther	(S)-2-HYDROXY-ACID OXIDASE-RELATED	JGI		ISS
PF01070	PFAM	FMN-dependent dehydrogenase	JGI		ISS
UniRef100_D7EZN6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Glycolate oxidase n=1 Tax=Mikania micrantha RepID=D7EZN6_9ASTR	SoyBase	E_val: 0	ISS
UniRef100_I1KRU4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KRU4_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g10230

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g10230 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g096600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g10230

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g10230

Limit To All Plant Sequences

>Glyma08g10230.2   sequence type=CDS   gene model=Glyma08g10230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGATGGATATGATAACTAATGTTAACGAGTATGAGGCAATTGCAAAGGAAAAATTGCCAAAGATGGTTTATGATTACTATGCGTTCCGACCGCGGATTCTTGTTGATGTAAGCAAGATAGACTTGACTGCAACTGTATTGGGCTTCAAAATATCAATGCCTATCATGATTGCTCCAACAGCCATGCAAAAGATGGCCCACCCTGAAGGAGAATTAGCTACTGCTAGAGCAGCATCAGCAGCTGGCACAATCATGGTGTTTAAAGATAGAAATGTGGCTGCTCAGCTCGTGAGAAGAGCTGAAAGAGCTGGTTTTAAGGCGATTGCCCTTACTGTGGACACTCCAATTCTTGGTCGTAGGGAGGCTGACATCAAAAACAGATTTACATTGCCATCACACCTGGTATTGAAGAATTTTGAAGGATTGGATCTTAGAAAACTGGACAAGACTAGTGACTCTAATGTTGCCTCCTATGTTGCTGGACCATTTGATCAGTCATTCAACTGGAAGGATATCCAATGGCTCCAAACAATCACTTCATTGCCAATTTTATTAAAGGGTGTACTTACAGCTGAAGATACAAGGATAGCCGTACAAGCTGGAGTTGCTGGAATCATTGTTTCCAATCATGGAGCTCGCCAACTTGACTATGTCCCTGCTACTATTATGGCTTTGGAAGAGGTAGTTAAAGCTGCACAAGGAAGGATTCCAGTTTTTCTGGATGGTGGAATTCGTAGAGGTACAGATGTTTTTAAAGCACTAGCTCTTGGAGCAGCTGGTGTATTCATTGGTAGACCAGTGCTGTTTTCATTGGCTGCTGATGGTGAGGCTGGTGTGAGAAAAGTACTTCAAATGCTTCGTGATGAGTTTGAACTAACTATGGCTCTAAGTGGTTGCCGTTCACTCAAGGAGATAACTCGTGACCATGTTGTCACAGAGTGGGATCGCCCAAGATTTGCTCCTAAGTTATGA

Predicted protein sequences of Glyma08g10230

Limit To All Plant Sequences

>Glyma08g10230.2   sequence type=predicted peptide   gene model=Glyma08g10230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKMDMITNVNEYEAIAKEKLPKMVYDYYAFRPRILVDVSKIDLTATVLGFKISMPIMIAPTAMQKMAHPEGELATARAASAAGTIMVFKDRNVAAQLVRRAERAGFKAIALTVDTPILGRREADIKNRFTLPSHLVLKNFEGLDLRKLDKTSDSNVASYVAGPFDQSFNWKDIQWLQTITSLPILLKGVLTAEDTRIAVQAGVAGIIVSNHGARQLDYVPATIMALEEVVKAAQGRIPVFLDGGIRRGTDVFKALALGAAGVFIGRPVLFSLAADGEAGVRKVLQMLRDEFELTMALSGCRSLKEITRDHVVTEWDRPRFAPKL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain