Glyma08g09840 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g09840

Feature Type:	gene_model
Chromosome:	Gm08
Start:	7037006
stop:	7037810
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g09840

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G03430	AT	Annotation by Michelle Graham. TAIR10: Calcium-binding EF-hand family protein \| chr3:814481-814732 FORWARD LENGTH=83	SoyBase	E_val: 4.00E-26	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0019722	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium-mediated signaling	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
PTHR24753	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24753:SF39	Panther		JGI		ISS
PF00036	PFAM	EF hand	JGI		ISS
UniRef100_G9HSF6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Group 7 grass pollen allergen n=1 Tax=Triticum turgidum subsp. durum x Secale cereale RepID=G9HSF6_9POAL	SoyBase	E_val: 3.00E-25	ISS
UniRef100_I1KRQ2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KRQ2_SOYBN	SoyBase	E_val: 6.00E-50	ISS

Expression Patterns of Glyma08g09840

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g09840

Paralog	Evidence	Comments
Glyma05g26890	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g09840 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g093000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g09840

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g09840

Limit To All Plant Sequences

>Glyma08g09840.1   sequence type=CDS   gene model=Glyma08g09840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGAAAGAGAAGAGTGTGAGCGCGTTTTCAAGCGCTTTGATGTGAATGGCGATGGCAACATCTCCTTGTCCGAGTTTGCAGATGCTCTCAAAGTGCTAGGCTTAACTTCACAGGAGGAAGTTGAGCGTCGAATGAAAGAGATAGATAAAGATGGTGATGGATACATTACACTCGAAGAGTTGATTGAATTTCATACTGCCAACCCTAGTTTGATGAGGGATGTCTTGAAGAAACTCTAA

Predicted protein sequences of Glyma08g09840

Limit To All Plant Sequences

>Glyma08g09840.1   sequence type=predicted peptide   gene model=Glyma08g09840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSEREECERVFKRFDVNGDGNISLSEFADALKVLGLTSQEEVERRMKEIDKDGDGYITLEELIEFHTANPSLMRDVLKKL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain