SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g09180

Feature Type:gene_model
Chromosome:Gm08
Start:6561988
stop:6567387
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g09180
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G63980AT Annotation by Michelle Graham. TAIR10: Inositol monophosphatase family protein | chr5:25609840-25611802 FORWARD LENGTH=407 SoyBaseE_val: 0ISS
GO:0006401GO-bp Annotation by Michelle Graham. GO Biological Process: RNA catabolic process SoyBaseN/AISS
GO:0006790GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound metabolic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009968GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of signal transduction SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010587GO-bp Annotation by Michelle Graham. GO Biological Process: miRNA catabolic process SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0019932GO-bp Annotation by Michelle Graham. GO Biological Process: second-messenger-mediated signaling SoyBaseN/AISS
GO:0043157GO-bp Annotation by Michelle Graham. GO Biological Process: response to cation stress SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048015GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylinositol-mediated signaling SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051512GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of unidimensional cell growth SoyBaseN/AISS
GO:0080141GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004441GO-mf Annotation by Michelle Graham. GO Molecular Function: inositol-1,4-bisphosphate 1-phosphatase activity SoyBaseN/AISS
GO:0008441GO-mf Annotation by Michelle Graham. GO Molecular Function: 3'(2'),5'-bisphosphate nucleotidase activity SoyBaseN/AISS
GO:0019204GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide phosphatase activity SoyBaseN/AISS
KOG1528 KOG Salt-sensitive 3'-phosphoadenosine-5'-phosphatase HAL2/SAL1 JGI ISS
PTHR20854Panther INOSITOL MONOPHOSPHATASE JGI ISS
PTHR20854:SF3Panther DIPHOSPHONUCLEOSIDE PHOSPHOHYDROLASE JGI ISS
PF00459PFAM Inositol monophosphatase family JGI ISS
UniRef100_I1KRI3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KRI3_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q42546UniRef Annotation by Michelle Graham. Most informative UniRef hit: SAL1 phosphatase n=1 Tax=Arabidopsis thaliana RepID=DPNP1_ARATH SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g09180
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g09180
ParalogEvidenceComments
Glyma05g26250 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g09180 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g086800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g09180
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g09180
>Glyma08g09180.1   sequence type=CDS   gene model=Glyma08g09180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTACTCAAACAACACTTTGGTGTAGAGCAAGAACTACTATAAGTGTAGGAGGTGATTGGAAGTTGTTCGAATCCAGAATCCGAAAAAAGGGCACCACCGTGTCAACAAGTAGAAGCAGAAGCTGTTTTTGTTCTTCGCCGCTGACACTAATCGTTTCTTCAATGCCTTACGAGAAGGAATTCGCCGCTGCAAAAAAAGCAGCCACTCTCGCTGCTCGTCTCTGCAAGAAAGTACAGAAGGCTCTTCTGCAATCCGATGTGCACTCAAAGTCAGACAAAAGTCCTGTCACAGTGGCTGATTATGGTTCACAAGCATTGGTCAGCTTTATACTTGAGAGAGAACTTCCTTCTGAACCATTTTCATTAGTAGCTGAGGAGGATTCAGGTGATCTTCGTAAGGAGAGTGGTCAGGATACGCTGAAGCGCATTACAGAACTTGTCAATGATACCCTTGCTAGTGAAGGATCAAATAGCTTTTCTACTTTAACAACAGATGATGTGCTTGCGGCCATTGACGGTGGTAAATCTGAAGGTGGTTCAGTTGGACGGCACTGGGTTTTGGATCCGATAGATGGTACTAAAGGGTTTGTAAGAGGAGATCAATATGCTATAGCGTTAGCTTTACTAGATGAAGGCAAAGTTGTATTGGGTGTCTTGGCTTGTCCAAACCTTCCACTGGCATCCATTGGCTCCAATCAGCAGCTTTCTTCTTCAAATGAAGTTGGTTGTCTCTTCTTTGCTAAAGTTGGTGATGGAACATATATGCAAGCACTGGGTGGTTCTACACAAACTAGGGTGCATGTCTGTGATATTGATAACCCAGAGGAAGCATCATTTTTTGAATCTTTTGAAGCAGCACACTCCTCACATGACTTATCTAGCTCCATTGCAGAAAAACTCGGTGTCAAAGCACCACCAGTCAGAATTGATAGCCAAGCAAAATATGGAGCTTTGTCAAGAGGAGATGGGGCTATATATTTGCGTTTCCCTCACAAAGGATACCGTGAAAAAATATGGGATCATGCTGCTGGCAGCATTGTTGTGACTGAAGCTGGAGGTATCGCCATGGATGCTGCGGGGAACCCTCTGGACTTTTCAAAAGGAAAGTTTCTTGATGTTGTATCTGGTATTATCGTTACAAACCAGAAATTGAAGGCATCGCTTTTGAGAGCAGTTAAAGAAGCACTCAATGAGAAAGTTTCATCCTTGTGA
Predicted protein sequences of Glyma08g09180
>Glyma08g09180.1   sequence type=predicted peptide   gene model=Glyma08g09180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGTQTTLWCRARTTISVGGDWKLFESRIRKKGTTVSTSRSRSCFCSSPLTLIVSSMPYEKEFAAAKKAATLAARLCKKVQKALLQSDVHSKSDKSPVTVADYGSQALVSFILERELPSEPFSLVAEEDSGDLRKESGQDTLKRITELVNDTLASEGSNSFSTLTTDDVLAAIDGGKSEGGSVGRHWVLDPIDGTKGFVRGDQYAIALALLDEGKVVLGVLACPNLPLASIGSNQQLSSSNEVGCLFFAKVGDGTYMQALGGSTQTRVHVCDIDNPEEASFFESFEAAHSSHDLSSSIAEKLGVKAPPVRIDSQAKYGALSRGDGAIYLRFPHKGYREKIWDHAAGSIVVTEAGGIAMDAAGNPLDFSKGKFLDVVSGIIVTNQKLKASLLRAVKEALNEKVSSL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo