Glyma08g08820 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g08820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g08820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g08820

Feature Type:	gene_model
Chromosome:	Gm08
Start:	6286755
stop:	6288989
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g08820

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G05740	AT	Annotation by Michelle Graham. TAIR10: RECQ helicase l1 \| chr3:1698180-1701228 FORWARD LENGTH=606	SoyBase	E_val: 3.00E-109	ISS
GO:0006261	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication	SoyBase	N/A	ISS
GO:0006310	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA recombination	SoyBase	N/A	ISS
GO:0042631	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to water deprivation	SoyBase	N/A	ISS
GO:0070417	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to cold	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0004386	GO-mf	Annotation by Michelle Graham. GO Molecular Function: helicase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0008026	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP-dependent helicase activity	SoyBase	N/A	ISS
PTHR13710	Panther	DNA HELICASE RECQ FAMILY MEMBER	JGI		ISS
PTHR13710:SF13	Panther	RECQ HELICASE 5	JGI		ISS
PF00271	PFAM	Helicase conserved C-terminal domain	JGI		ISS
UniRef100_G7I9G1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Bloom syndrome protein-like protein n=1 Tax=Medicago truncatula RepID=G7I9G1_MEDTR	SoyBase	E_val: 9.00E-140	ISS
UniRef100_I1KRE6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1KRE6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g08820

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g08820 not represented in the dataset	Glyma08g08820 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g08820 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma08g08820

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g08820

Limit To All Plant Sequences

>Glyma08g08820.1   sequence type=CDS   gene model=Glyma08g08820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CGTCTAAACGCTCCACACGGTGCGGAGACATTGGCAATGCAAGAAATCCATCAAGCACAAATGGAACAATTACACAAGAAAATTGAGGATGACTTAGAGGTCTCAAGAAGGATGCTATCTTTCAATGTTATACAGGGATTGGGATCTCTTAAGCTACACTTTCCAGATGTACCTGTCATGGCATTGACTGCCACTGCAAGGCATGCAGTTCGTGAGGACATCTTGAAGGCTTTAAGAATTCCCCATGCACTTGTTCTTGAAAGAAGCTTTGACCGACCAAATTTGAAATATGAAGTGATTGCTAAGACAAAGGAGCCAATAAAGCAGCTTGGACAGTTACTAATTGATCGCTTCAGGAATCAATGTGGAATTGTTTACTGCCTTTCAAAAAGTGAATGTGTTGAGCTCTCCAAATTATTGAGTGAGAAATGCAAGATCAAAACAGTGTATTATCATTCTGGCTTGTCTGCCCACCAGAGAGTAGCCGTCCATATTGTATGTGCAACTATTGCTTTTGGAATGTGGATAGACAAACCTGATGTTCGCTTTGTCATCCACAATACAATGTCAAAATCAATTGAAAGCTATTATCAAGAATCTGGAAGGGCTGGAAGAGATAATTTTTCTTCAGTTTGCATTGCTCTACACCAGAAGAAAGATTTTAGTAGAGTTGTATGCATGATAAGAAATGGCCAAGGATATAAAAAGGAAAGTTTTAAGACAGCAATGGCTCACATCTATGCTGAATGCCGGAGACAAACTTTACTCAAACATTTTGGAGAATCTTTTGATAGAAGAGACTGCAAGTATGGATCTAGCCCCTGTGATAACTGTCTCAAGACTGTATTGTG

Predicted protein sequences of Glyma08g08820

Limit To All Plant Sequences

>Glyma08g08820.1   sequence type=predicted peptide   gene model=Glyma08g08820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RLNAPHGAETLAMQEIHQAQMEQLHKKIEDDLEVSRRMLSFNVIQGLGSLKLHFPDVPVMALTATARHAVREDILKALRIPHALVLERSFDRPNLKYEVIAKTKEPIKQLGQLLIDRFRNQCGIVYCLSKSECVELSKLLSEKCKIKTVYYHSGLSAHQRVAVHIVCATIAFGMWIDKPDVRFVIHNTMSKSIESYYQESGRAGRDNFSSVCIALHQKKDFSRVVCMIRNGQGYKKESFKTAMAHIYAECRRQTLLKHFGESFDRRDCKYGSSPCDNCLKTVL

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain