SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g08781

Feature Type:gene_model
Chromosome:Gm08
Start:6271374
stop:6272798
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g08781
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G46330AT Annotation by Michelle Graham. TAIR10: Leucine-rich receptor-like protein kinase family protein | chr5:18791802-18795407 FORWARD LENGTH=1173 SoyBaseE_val: 5.00E-98ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006898GO-bp Annotation by Michelle Graham. GO Biological Process: receptor-mediated endocytosis SoyBaseN/AISS
GO:0007169GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane receptor protein tyrosine kinase signaling pathway SoyBaseN/AISS
GO:0010359GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of anion channel activity SoyBaseN/AISS
GO:0016045GO-bp Annotation by Michelle Graham. GO Biological Process: detection of bacterium SoyBaseN/AISS
GO:0016310GO-bp Annotation by Michelle Graham. GO Biological Process: phosphorylation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0052544GO-bp Annotation by Michelle Graham. GO Biological Process: defense response by callose deposition in cell wall SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004675GO-mf Annotation by Michelle Graham. GO Molecular Function: transmembrane receptor protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG0580 KOG Serine/threonine protein kinase JGI ISS
PTHR24420Panther FAMILY NOT NAMED JGI ISS
PTHR24420:SF841Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_G8G288UniRef Annotation by Michelle Graham. Most informative UniRef hit: Flagellin-sensing 2-like protein n=1 Tax=Lotus japonicus RepID=G8G288_LOTJA SoyBaseE_val: 2.00E-134ISS
UniRef100_I1KRE5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1KRE5_SOYBN SoyBaseE_val: 2.00E-167ISS

Expression Patterns of Glyma08g08781
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g08781 not represented in the dataset
Glyma08g08781 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g08781 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g083000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g08781
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g08781
>Glyma08g08781.1   sequence type=CDS   gene model=Glyma08g08781   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGCTCTTGCAGATTGGCTTGACACTCACCACCACTGCAACTGGTCTGGCATTGCATAAGAGCATATCTATTATTGCTTCACTTGGATCACTTGCTATACTACTATTATTAGTCTTGGTGATTCTAATTCTCAATAGAGGTATCAAACTCTGCAATTCTAAAGAAAGGGATATTAGTGCGAATCATGGACCAGAATACAGTTCAGCATTGCCACTTAAAAGGTTCAATCCAAAGGACTTGGAAAATGCAACTGGTTTTTTCAGCTATGACAGCATCATTGGTGCTAGTAGTTTGAGCACAGTTTACAAGGGTCAAATGGAAGATGACCAGTTTGTTGCCATAAAAAGATTGAATTTGCAACAGTTCTCTGTAAATACTGACAAGATCTTCAAGAGGGAAGCCAAAATCTTGTGCCAGATGAGACATAGGAATTTGGTTAAGGTACTTGGATATGCCTGGGAGAGTGGGAAAATGAAGGCTTTGGTTCTAGAGTACATGGAGAATGGGAATTTGGATGGCATAATACATGACAAAGGGAAAGATGAGTCTGTGATCTCTAGGTGGACATTATCTGAAAGAGTCCGAGTTTTCATTTCTATTGCTAGTGCATTGGATTATCTGCACTCTGGTTATGATTTTCCCATTGTACACTGTGAGTTAAAGCCTTCTAACATCCTTCTAGATAGAGATTGGGAAGCTCATGTCAGTGACTTTGGGACAGCTCGAATACTTGGCCTTCATCTGCAGGATGGTAGTACCCTTTCCTCATCTGCAGCTTTGCAAGGCACATTGGGCTATATGGCACCAGAATTTGCCTACATGAGGAAAGTAACCACTAAAGCAGATGTGTTCAGCTTCGGTGTCATAGTAATGGAGTTTCTAACAAAAAGAAGGCCGACAGGACTCTAA
Predicted protein sequences of Glyma08g08781
>Glyma08g08781.1   sequence type=predicted peptide   gene model=Glyma08g08781   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGLLQIGLTLTTTATGLALHKSISIIASLGSLAILLLLVLVILILNRGIKLCNSKERDISANHGPEYSSALPLKRFNPKDLENATGFFSYDSIIGASSLSTVYKGQMEDDQFVAIKRLNLQQFSVNTDKIFKREAKILCQMRHRNLVKVLGYAWESGKMKALVLEYMENGNLDGIIHDKGKDESVISRWTLSERVRVFISIASALDYLHSGYDFPIVHCELKPSNILLDRDWEAHVSDFGTARILGLHLQDGSTLSSSAALQGTLGYMAPEFAYMRKVTTKADVFSFGVIVMEFLTKRRPTGL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo