SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g08290

Feature Type:gene_model
Chromosome:Gm08
Start:5950006
stop:5951609
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G68150AT Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 9 | chr1:25543970-25545615 FORWARD LENGTH=374 SoyBaseE_val: 1.00E-66ISS
GO:0000041GO-bp Annotation by Michelle Graham. GO Biological Process: transition metal ion transport SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006826GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion transport SoyBaseN/AISS
GO:0010043GO-bp Annotation by Michelle Graham. GO Biological Process: response to zinc ion SoyBaseN/AISS
GO:0010106GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
PF03106PFAM WRKY DNA -binding domain JGI ISS
UniRef100_B9SPL6UniRef Annotation by Michelle Graham. Most informative UniRef hit: WRKY transcription factor, putative n=1 Tax=Ricinus communis RepID=B9SPL6_RICCO SoyBaseE_val: 1.00E-77ISS
UniRef100_I1KR89UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1KR89_SOYBN SoyBaseE_val: 1.00E-143ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma05g25270 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g08290.2   sequence type=CDS   gene model=Glyma08g08290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAATTCTCAGCCATCCAGGAAAACAATAAAAGAAAGGATCATGAAATTTCTCTCTCACTTCAAGACATTGCGACCACCAGCGGTGAAGGACCATCGAGAATTAATGAGATCTTTAACAAACAAATTCGCCAAAGTGCTCCATCTCCTCCACACACTACTGATCATGATGATAGTTTAAGCGAGAGTGAATTGGGTTTATCACTAAGGTTGCAACCAAGCACAAGTCATCATAAAGAAAGTGATGTGGGAAATAACAATAAGGAAGACAAAAATGATCAACAATTGGCAAGTTTTGCATCAGTGCAGAACAAACTACAGCGGACACATGAGTTGCCTGGTATTACTACCCATGCTGCTTTCCCTCCTAACAGAAAGGCTAGGGTTTCGGTTAGAGCAAGATGTGAAGCTGCCACAATGAATGATGGGTGCCAATGGAGAAAATATGGGCAGAAAATTGCAAAAGGAAATCCATGTCCACGAGCCTATTATCGTTGCACTGTAGCCCCAGGCTGCCCTGTTAGGAAACAGGTGCAAAGATGTATAGATGACATGTCCATACTAATCACAACCTATGAAGGGACACATAACCATCCACTCCCTGTGGGTGCAACTGCTATGGCTTCCACAGCTTCTGCAGCAGCTTCCTTCATGTTGCTAGACTCAAGCAACCCCATTTCAGATGGCACCTCAAGCTTCACTCAAGCACCATTTCCTTACAACACCTTCCACCCTCTAAACCCAGCTTCAAATTTCAGGAGCATAAGCCCTAGTGATCCATCCAAAGGGATT

>Glyma08g08290.2   sequence type=predicted peptide   gene model=Glyma08g08290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKFSAIQENNKRKDHEISLSLQDIATTSGEGPSRINEIFNKQIRQSAPSPPHTTDHDDSLSESELGLSLRLQPSTSHHKESDVGNNNKEDKNDQQLASFASVQNKLQRTHELPGITTHAAFPPNRKARVSVRARCEAATMNDGCQWRKYGQKIAKGNPCPRAYYRCTVAPGCPVRKQVQRCIDDMSILITTYEGTHNHPLPVGATAMASTASAAASFMLLDSSNPISDGTSSFTQAPFPYNTFHPLNPASNFRSISPSDPSKGI







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo