SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g08210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g08210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g08210

Feature Type:gene_model
Chromosome:Gm08
Start:5865767
stop:5869393
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G60360AT Annotation by Michelle Graham. TAIR10: embryo sac development arrest 14 | chr3:22312477-22314002 REVERSE LENGTH=228 SoyBaseE_val: 2.00E-103ISS
GO:0000741GO-bp Annotation by Michelle Graham. GO Biological Process: karyogamy SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009561GO-bp Annotation by Michelle Graham. GO Biological Process: megagametogenesis SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0032040GO-cc Annotation by Michelle Graham. GO Cellular Compartment: small-subunit processome SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG3237 KOG Uncharacterized conserved protein JGI ISS
PTHR12838Panther U3 SMALL NUCLEOLAR RNA-ASSOCIATED PROTEIN 11 JGI ISS
PF03998PFAM Utp11 protein JGI ISS
UniRef100_B9RV90UniRef Annotation by Michelle Graham. Most informative UniRef hit: U3 small nucleolar RNA-associated protein, putative n=1 Tax=Ricinus communis RepID=B9RV90_RICCO SoyBaseE_val: 1.00E-119ISS
UniRef100_I1KR80UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KR80_SOYBN SoyBaseE_val: 3.00E-167ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g08210 not represented in the dataset

Glyma08g08210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma05g25190 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g077300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g08210.1   sequence type=CDS   gene model=Glyma08g08210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTTCTCTTCGAAACGCCATTCCCAGGCGTGCTCACAAAGAGCGTTCTCAACCGTCGTCGAGGAAAAAATTCGGCCTTCTCGAAAAGCACAAGGACTATATCCAGCGTGCTAAAGCATTCCACAAGAAAGAAGACACTTTGCGGAAACTTAGGGAAAAAGCAGCGAATAGAAATGAAGATGAATTTTACTTCAAGATGGTTAGAACAAAAACCGTTGATGGAGTTCATAAACCAGAGAGTGAAGCGAATAAGTATACTCAGGAAGAGCTTATGCTGATGAAGACTCAGGACATGGGTTACATTCTTCAGAAGATTCAGAGTGAGAGAAATAAAATTGAAAGGCTAACTGCCTCACTGCACTCTATCGATAATCAGCCGGCGAACAAGCATGTTTTCTTTGCTGAGGACAGGGAAGAGGCTAAAGAGTTAGAATCACGACATCAAAAAAGTAAAATTCCACTTACTTCTGGTGATATTCCTGCTGGCATTAAGAGAAAAACAGATCGGTCTTACCAAGAGTTGGAAGCAAGGAGGGGTAGACTCAGCCAACTAGAGAAAATCTACATGGATATGACAATGCAGAAGGAGTTGCAGAAAAAAGGTAGGAAGCGCAAACTACGTGAAGACGAGATTGTTTGTCCAACAACTAAACCGGTATACATGTGGCGTGCTGAAAGAAAGCGTTGA

>Glyma08g08210.1   sequence type=predicted peptide   gene model=Glyma08g08210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSLRNAIPRRAHKERSQPSSRKKFGLLEKHKDYIQRAKAFHKKEDTLRKLREKAANRNEDEFYFKMVRTKTVDGVHKPESEANKYTQEELMLMKTQDMGYILQKIQSERNKIERLTASLHSIDNQPANKHVFFAEDREEAKELESRHQKSKIPLTSGDIPAGIKRKTDRSYQELEARRGRLSQLEKIYMDMTMQKELQKKGRKRKLREDEIVCPTTKPVYMWRAERKR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo