SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g08051

Feature Type:gene_model
Chromosome:Gm08
Start:5782860
stop:5787383
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g08051
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G26420AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein with retrovirus zinc finger-like domain | chr3:9671953-9673055 FORWARD LENGTH=245 SoyBaseE_val: 9.00E-65ISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009631GO-bp Annotation by Michelle Graham. GO Biological Process: cold acclimation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG4207 KOG Predicted splicing factor, SR protein superfamily JGI ISS
PTHR24012Panther FAMILY NOT NAMED JGI ISS
PTHR24012:SF188Panther JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
PF00098PFAM Zinc knuckle JGI ISS
UniRef100_C6T2P6UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T2P6_SOYBN SoyBaseE_val: 1.00E-116ISS
UniRef100_G7IL96UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycine-rich RNA-binding protein n=1 Tax=Medicago truncatula RepID=G7IL96_MEDTR SoyBaseE_val: 7.00E-73ISS

Expression Patterns of Glyma08g08051
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g08051 not represented in the dataset
Glyma08g08051 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g08051
ParalogEvidenceComments
Glyma05g24960 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g08051 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g075700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g08051
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g08051
>Glyma08g08051.1   sequence type=CDS   gene model=Glyma08g08051   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGACGTGGAAGAGTATCGTTGTTTCATTGGTGGCCTTGCGTGGTCAACATCTGATAGAAAGTTAAAGGATACGTTTGAAAAGTTTGGCAAGCTTATTGAGGCAAAGGTGGTTGTTGACAAGTTCTCTGGGCGTTCTCGTGGTTTTGGATTTGTCACATTTGATGACAAGAAAGCAATGGACGAGGCTATTGATGCTATGAATGGGATGGATTTAGACGGGCGAACTATTACTGTTGATAGAGCTCAGCCTCAACAAGGATCAACTAGAGGTGATGGTGATCGCTACCGGGATCGTGGTCGTGATCGTGACCGAGATCATGGAGGTGGAGGTGGCCGAGGATCTAATGGTGGTGAATGCTTTAAGTGTGGAAAACCTGGTCATTTTGCTAGGGAGTGCCCTAGTGAAGGGTCCAGGGGAGGAAAGTATGGTGGTAGGGAAAGTAGATATGGTGGAAGCAGTGGTGGTGGTTATGGACCAGATAGAGCAGATCGTTCTTCAGGGGGGCGCAGCAGGGGATGGTGGTAG
Predicted protein sequences of Glyma08g08051
>Glyma08g08051.1   sequence type=predicted peptide   gene model=Glyma08g08051   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSDVEEYRCFIGGLAWSTSDRKLKDTFEKFGKLIEAKVVVDKFSGRSRGFGFVTFDDKKAMDEAIDAMNGMDLDGRTITVDRAQPQQGSTRGDGDRYRDRGRDRDRDHGGGGGRGSNGGECFKCGKPGHFARECPSEGSRGGKYGGRESRYGGSSGGGYGPDRADRSSGGRSRGWW*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo