SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g07941): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g07941): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g07941

Feature Type:gene_model
Chromosome:Gm08
Start:5688751
stop:5691530
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G37340AT Annotation by Michelle Graham. TAIR10: arginine/serine-rich zinc knuckle-containing protein 33 | chr2:15670372-15672331 REVERSE LENGTH=290 SoyBaseE_val: 2.00E-52ISS
GO:0000245GO-bp Annotation by Michelle Graham. GO Biological Process: spliceosomal complex assembly SoyBaseN/AISS
GO:0000398GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome SoyBaseN/AISS
GO:0008380GO-bp Annotation by Michelle Graham. GO Biological Process: RNA splicing SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0016607GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear speck SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0107 KOG Alternative splicing factor SRp20/9G8 (RRM superfamily) JGI ISS
PTHR10548Panther ARGININE/SERINE-RICH SPLICING FACTOR JGI ISS
PTHR10548:SF26Panther ARGININE/SERINE-RICH ZINC KNUCKLE-CONTAINING PROTE JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_B9SGV2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Arginine/serine-rich splicing factor, putative n=1 Tax=Ricinus communis RepID=B9SGV2_RICCO SoyBaseE_val: 9.00E-59ISS
UniRef100_C6TMH9UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TMH9_SOYBN SoyBaseE_val: 3.00E-114ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g07941 not represented in the dataset

Glyma08g07941 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g074600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g07941.1   sequence type=CDS   gene model=Glyma08g07941   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCTCGCCATGATGATAAATATAGTAATACCCGCCTCGACGTTGGACACTTGTCTTCGATGACTCGTTCCCGTGACCTGGAGCGTGTCTTCAGCAGATATGGAAGAGTTCAAGGTGTGGATATGAAGAATTTTTTCGCCTTTGTTGACTTTGGCGATCCTCGAGATGCTGATGATGCTAGATATAACTTGGATGGTCGTGAAGTTGAAGGAAGGCACGTTACTGTGGAATTTGCCAAGGGGGGTCCTCGTGGTTCCTGGGAATCCTCAGGTCAGGGTCAGGGTCCACCTACTGGACCTGGACGATATTGCAAAACTGGGGATGGGAAGAACAAGTGTTTCCTTAGTGGGGAAAGAGGTCATATAGAAAAGAACTGTAAGAACAGTCCCAAAAAGTTGAGGTCACATTCTGCTCATCATGGCAGAAGAAGGGATCGAAGCTACAGCCGAGACCGCAGCTACAGTCGATCAATATCTCCTGTCGGAAGAGAACGAAGCCCAGTTTCTGAAGATAGATCAGATGCATCACTTGACCAAAGCAGTCCACAGAAGAGAGGTGTCACATCTCCTGGCAGTGATAGGTTGGCCACCCGGCAAGATGGGTCTGACTACAGTGGTGGTCCTAGAAAGAAAAGTAGGAGCCCTGCAAGGGACTGTGATGAGGGCGGCTATGATAGCCCTAAAGTTAATGGGCATAGCCGTAGCCTTAGGGATGATGACAAGAGCCCCATTGATGAAGATGATGACAACCACCGTCGCTCACTGTCACCTTGA

>Glyma08g07941.1   sequence type=predicted peptide   gene model=Glyma08g07941   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPRHDDKYSNTRLDVGHLSSMTRSRDLERVFSRYGRVQGVDMKNFFAFVDFGDPRDADDARYNLDGREVEGRHVTVEFAKGGPRGSWESSGQGQGPPTGPGRYCKTGDGKNKCFLSGERGHIEKNCKNSPKKLRSHSAHHGRRRDRSYSRDRSYSRSISPVGRERSPVSEDRSDASLDQSSPQKRGVTSPGSDRLATRQDGSDYSGGPRKKSRSPARDCDEGGYDSPKVNGHSRSLRDDDKSPIDEDDDNHRRSLSP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo