Glyma08g07330 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g07330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g07330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g07330

Feature Type:	gene_model
Chromosome:	Gm08
Start:	5260106
stop:	5260914
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g07330

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G07400	AT	Annotation by Michelle Graham. TAIR10: HSP20-like chaperones superfamily protein \| chr1:2275148-2275621 FORWARD LENGTH=157	SoyBase	E_val: 8.00E-80	ISS
GO:0006979	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to oxidative stress	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
KOG0710	KOG	Molecular chaperone (small heat-shock protein Hsp26/Hsp42)	JGI		ISS
PTHR11527	Panther	SMALL HEAT-SHOCK PROTEIN (HSP20) FAMILY	JGI		ISS
PTHR11527:SF14	Panther	LETHAL(2) ESSENTIAL FOR LIFE - RELATED	JGI		ISS
PF00011	PFAM	Hsp20/alpha crystallin family	JGI		ISS
UniRef100_C6T5U3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T5U3_SOYBN	SoyBase	E_val: 6.00E-105	ISS
UniRef100_P02519	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 17.3 kDa class I heat shock protein n=2 Tax=Glycine max RepID=HSP11_SOYBN	SoyBase	E_val: 7.00E-102	ISS

Expression Patterns of Glyma08g07330

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g07330 not represented in the dataset	Glyma08g07330 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g07330 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g068700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g07330

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g07330

Limit To All Plant Sequences

>Glyma08g07330.1   sequence type=CDS   gene model=Glyma08g07330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCTGATTCCAAGTTTCTTCGGTGGCCGAAGGAGCAGTGTTTTCGACCCTTTCTCCCTCGATGTGTGGGAGCCCTTTAAGGATTTTCCATTTCCCAGTTCTCTTTCTGCTGAAAATTCAGCCTTTGTGAGCACACGAGTGGATTGGAAGGAGACACCAGAAGCACACGTGTTCAAGGCTGATATTCCAGGGCTGAAGAAGGAGGAAGTGAAGCTGGAGATTCAAGATGACAGAGTTCTTCAGATAAGCGGAGAGAGGAATGTTGAAAAAGAAGACAAGAATGATACGTGGCATCGCGTGGAGCGAAGCAGTGGTAAGTTCATGAGGAGGTTTAGATTGCCGGAGAATGCTAAAGTGGATCAAGTTAAGGCTTCCATGGAAAATGGGGTTCTCACTGTAACTGTTCCTAAGGAAGAGATTAAGAAGCCTGATGTTAAGGCCATTGACATCTCTGGTTAA

Predicted protein sequences of Glyma08g07330

Limit To All Plant Sequences

>Glyma08g07330.1   sequence type=predicted peptide   gene model=Glyma08g07330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSLIPSFFGGRRSSVFDPFSLDVWEPFKDFPFPSSLSAENSAFVSTRVDWKETPEAHVFKADIPGLKKEEVKLEIQDDRVLQISGERNVEKEDKNDTWHRVERSSGKFMRRFRLPENAKVDQVKASMENGVLTVTVPKEEIKKPDVKAIDISG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain