SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g06440

Feature Type:gene_model
Chromosome:Gm08
Start:4610271
stop:4612102
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g06440
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G21440AT Annotation by Michelle Graham. TAIR10: MYB-like 102 | chr4:11418425-11419652 REVERSE LENGTH=350 SoyBaseE_val: 9.00E-112ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0015824GO-bp Annotation by Michelle Graham. GO Biological Process: proline transport SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
KOG0048 KOG Transcription factor, Myb superfamily JGI ISS
PTHR10641Panther MYB-RELATED JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_G7JSV1UniRef Annotation by Michelle Graham. Most informative UniRef hit: R2R3-MYB transcription factor n=1 Tax=Medicago truncatula RepID=G7JSV1_MEDTR SoyBaseE_val: 1.00E-137ISS
UniRef100_I1KQR0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQR0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g06440
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g06440
ParalogEvidenceComments
Glyma07g30860 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g06440 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g059900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g06440
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g06440
>Glyma08g06440.1   sequence type=CDS   gene model=Glyma08g06440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTAGATCACCTTGTTGTGACAAAAATGGCCTCAAGAAAGGACCATGGACACCAGAAGAAGACCAGAAACTCTTTGATTACATTCAGAAACATGGGTACGGCAATTGGAGAGTACTCCCAAAGAATGCTGGTTTGCAAAGGTGCGGAAAAAGCTGTCGGCTTCGTTGGACAAACTATCTCCGACCAGATATAAAACGAGGTCGATTCACTTTGGAAGAGGAAGAGACCATAATACAACTACATAGCATTCTTGGCAACAAGTGGTCAGCTATTGCTACTCGCTTACCCGGAAGAACAGACAATGAAATCAAGAATTACTGGAACACCCACATTAGAAAAAGGCTTCTAAGGATGGGAATGGACCCTGTGACACATAGGCCAAGGCTTGATCTTTTGGACCTATCTTCCATCCTAAGTTCATCTCTCTATGGTTCAACACAAATGAACATCCAAAGACTTCTTGGCACTCACACGGTGGTGAACCCTGAGGTTCTAAAGTTGGCTTCATCACTCTTCCCCTCTCAGCAACGCGAAAACATCAACATGTGTGCACAAAATTGTGAAGAGAACCAGCTCTGTGACCCCCAAATTCAGAGCCAAATCCCTCATGACTTGGCTCAAGAAGCATTGCCTTTCACTCATGCACAGTTGGTTGAATCCAATACGATGAACACATACCCTTCAATTTTCCATGAATCTGGCTTCCAACAACATTATTCTCAACTAAGTGATTTGCATTACAACGGAATTGATCATAAAAGCTATGTTCCTCAATTACCAAGCTATGATTACCCTCCAATGTCTGAATCCTCAACTTATAACAATTCCTATAATAACAGCAACCAGAACTTCAGCTACGCTTCAGTTCTTTCAACGCCTTCTTCAAGTCCCACACCGTTGAATTCGAACTCGACGTTTGTCAAGGGGAGCAGCAGCACTGAGGATGAGACAGAAAGCTATGTCAGTAGCAACAACTTGTTGAGATTTGAAATCCCAGATATGCTACGTATGAATGAGTACTCATATAATTAA
Predicted protein sequences of Glyma08g06440
>Glyma08g06440.1   sequence type=predicted peptide   gene model=Glyma08g06440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRSPCCDKNGLKKGPWTPEEDQKLFDYIQKHGYGNWRVLPKNAGLQRCGKSCRLRWTNYLRPDIKRGRFTLEEEETIIQLHSILGNKWSAIATRLPGRTDNEIKNYWNTHIRKRLLRMGMDPVTHRPRLDLLDLSSILSSSLYGSTQMNIQRLLGTHTVVNPEVLKLASSLFPSQQRENINMCAQNCEENQLCDPQIQSQIPHDLAQEALPFTHAQLVESNTMNTYPSIFHESGFQQHYSQLSDLHYNGIDHKSYVPQLPSYDYPPMSESSTYNNSYNNSNQNFSYASVLSTPSSSPTPLNSNSTFVKGSSSTEDETESYVSSNNLLRFEIPDMLRMNEYSYN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo