Report for Sequence Feature Glyma08g06350
Feature Type: gene_model
Chromosome: Gm08
Start: 4501961
stop: 4503553
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g06350
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G26380 AT
Annotation by Michelle Graham. TAIR10: FAD-binding Berberine family protein | chr1:9126901-9128508 REVERSE LENGTH=535
SoyBase E_val: 0 ISS
GO:0009723 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus
SoyBase N/A ISS
GO:0055114 GO-bp
Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process
SoyBase N/A ISS
GO:0071456 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular response to hypoxia
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0005783 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum
SoyBase N/A ISS
GO:0003824 GO-mf
Annotation by Michelle Graham. GO Molecular Function: catalytic activity
SoyBase N/A ISS
GO:0008762 GO-mf
Annotation by Michelle Graham. GO Molecular Function: UDP-N-acetylmuramate dehydrogenase activity
SoyBase N/A ISS
GO:0009055 GO-mf
Annotation by Michelle Graham. GO Molecular Function: electron carrier activity
SoyBase N/A ISS
GO:0016491 GO-mf
Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity
SoyBase N/A ISS
GO:0016614 GO-mf
Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on CH-OH group of donors
SoyBase N/A ISS
GO:0050660 GO-mf
Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding
SoyBase N/A ISS
PTHR11748 Panther
D-LACTATE DEHYDROGENASE
JGI ISS
PTHR11748:SF29 Panther
SUBFAMILY NOT NAMED
JGI ISS
PF01565 PFAM
FAD binding domain
JGI ISS
PF08031 PFAM
Berberine and berberine like
JGI ISS
UniRef100_I1KQQ2 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQQ2_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q2HTZ1 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: FAD linked oxidase, N-terminal; TonB box, N-terminal n=1 Tax=Medicago truncatula RepID=Q2HTZ1_MEDTR
SoyBase E_val: 0 ISS
Expression Patterns of Glyma08g06350
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma08g06350
Paralog Evidence Comments
Glyma07g30940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g06350 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g059000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g06350
Coding sequences of Glyma08g06350
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g06350.1 sequence type=CDS gene model=Glyma08g06350 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAGCACTATCAAACCATTATGGTTTGTCCTCTCAACACTAATCTTTCTACTTTCTGCAACTTCGGATTCATCACCCCTTGAAAACTTTCTCCATTGTCTTTCAAAGCACTCAAGCCCTTCAATAACAAAAGCCATTTACACCCCACAAAATCCTTCATTTTTATCTATCTTGCACATGCACACATACAACCACAGATTTTCTGCACCAACAGCACCGAAACCTTTGGCTATTGTGACTGCTCTTGATGAGTCACATGTGCAAGGCACTGTTGTGTGTGCCAAGAGCAATGGAATTCAGATTAGGATCCGAAGTGGTGGCCATGACTGTGAAGGCCTTTCGTATGTTTCGGACGTGCCTTTTGTTGTTCTTGACATGTTTCATTTTGGATCAGTTGATGTAGACATTGAAAGTGGAACAGCATGGGCTGAATCTGGTGCAACACTTGGTGATGTTTACTATCACATTTCAGAGAAAAGTGGTGTTCATGGTTTCCCTGCTGGGGTTTGCCCCACTGTGGGTGCTGGTGGCCACTTCTCTGGTGGTGGCTATGGAAATCTCATGAGAAAATATGGTCTTTCTGTTGATAATATCATTGATGCAAAATTGGTTGATGTCAATGGTAACATTCTTGACAGAAAGTCAATGGGGGAAGATCTGTTTTGGGCTATAAGAGGAGGAGGTGGTGGTAGTTTTGGTGTCATTCTTTCATGGAAGATCAAGTTGGTTTATGTGACTCCAAAAGTGACTGTTTTCAAAGTGATGAGAAACTTGGAAGATGGTGCAAAGGGTCTTGTTTACAAGTGGCAATTGATTGCAACAAAATTGCATGACGATCTTTTCATAAGAGTGATGCATGATGTTGTTGATGGTACTCAAAAGGCCAAGAACAAGACCATAAAGGTTACTTTTATTGGTTTGTTCTTGGGAAAAAGTGATCAAATGTTGAGTTTGGTAAATGAGAGTTTTCCTGAATTGGGTTTGAAGCAAAGTGACTGCATTGAAATGCCATGGATCAATTCCACCCTTTATTGGTTCAATTACCCTATTGGGACCCCTATTAAGGCTTTGCTTGATGTGCCCAAAGAGCCCCTTTCATATAGCTTCAAAACCATGTCAGATTATGTGAAGAGGCCCATTAGAAAAAGTGCTCTTAAATCCATGTGGAAGCTTATGATTAAAAGTGAGAGTGTGAGGATGGAATGGAATCCTTATGGTGGGAAGATGCATGAGATTTCACCATCAGAAACTCCATTTCCTCATAGAGCAGGGAACTTGTTCTTGATTGAATACTTAACCACTTGGGGACAAGATGGGGTTGATGCTGCTAATCGTTACCTGAACATTTCAAGGTCATTCTATGAATTTATGACCCCATATGTTTCACACTCGCCAAGGGAGGCATTTCTCAACTATAGGGACCTTGATATAGGTTCCAATTTTCCAAGTAATGCAACAAACATGAACATTGCTCAAAGTTATGGGAGCAAGTATTTCAAAGGTAACTTTAAAAGATTGGTGAGAGTGAAATCTAAGGTTGATCCCGAGAACTTCTTCAGACATGAGCAGAGTATACCACCTCTTTCCCATTAG
Predicted protein sequences of Glyma08g06350
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g06350.1 sequence type=predicted peptide gene model=Glyma08g06350 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSTIKPLWFVLSTLIFLLSATSDSSPLENFLHCLSKHSSPSITKAIYTPQNPSFLSILHMHTYNHRFSAPTAPKPLAIVTALDESHVQGTVVCAKSNGIQIRIRSGGHDCEGLSYVSDVPFVVLDMFHFGSVDVDIESGTAWAESGATLGDVYYHISEKSGVHGFPAGVCPTVGAGGHFSGGGYGNLMRKYGLSVDNIIDAKLVDVNGNILDRKSMGEDLFWAIRGGGGGSFGVILSWKIKLVYVTPKVTVFKVMRNLEDGAKGLVYKWQLIATKLHDDLFIRVMHDVVDGTQKAKNKTIKVTFIGLFLGKSDQMLSLVNESFPELGLKQSDCIEMPWINSTLYWFNYPIGTPIKALLDVPKEPLSYSFKTMSDYVKRPIRKSALKSMWKLMIKSESVRMEWNPYGGKMHEISPSETPFPHRAGNLFLIEYLTTWGQDGVDAANRYLNISRSFYEFMTPYVSHSPREAFLNYRDLDIGSNFPSNATNMNIAQSYGSKYFKGNFKRLVRVKSKVDPENFFRHEQSIPPLSH*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
