SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g06170

Feature Type:gene_model
Chromosome:Gm08
Start:4389440
stop:4391854
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g06170
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G48420AT Annotation by Michelle Graham. TAIR10: D-cysteine desulfhydrase | chr1:17896767-17898803 REVERSE LENGTH=401 SoyBaseE_val: 3.00E-88ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009693GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019447GO-bp Annotation by Michelle Graham. GO Biological Process: D-cysteine catabolic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0032880GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein localization SoyBaseN/AISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0008660GO-mf Annotation by Michelle Graham. GO Molecular Function: 1-aminocyclopropane-1-carboxylate deaminase activity SoyBaseN/AISS
GO:0019148GO-mf Annotation by Michelle Graham. GO Molecular Function: D-cysteine desulfhydrase activity SoyBaseN/AISS
GO:0050897GO-mf Annotation by Michelle Graham. GO Molecular Function: cobalt ion binding SoyBaseN/AISS
PTHR10314Panther PYRIDOXAL-5-PHOSPHATE DEPENDENT BETA FAMILY JGI ISS
PTHR10314:SF6Panther THREONINE DEHYDRATASE-RELATED JGI ISS
UniRef100_G7LE92UniRef Annotation by Michelle Graham. Most informative UniRef hit: D-cysteine desulfhydrase n=1 Tax=Medicago truncatula RepID=G7LE92_MEDTR SoyBaseE_val: 8.00E-107ISS
UniRef100_I1KQN4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1KQN4_SOYBN SoyBaseE_val: 1.00E-163ISS

Expression Patterns of Glyma08g06170
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g06170
ParalogEvidenceComments
Glyma05g33540 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g06170 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma08g06170
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g06170
>Glyma08g06170.1   sequence type=CDS   gene model=Glyma08g06170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ACAACTTTGTCTCTCGCACAACACCATCCAAAACTAAAAGGGTATTTGTTGGGTTATATAGAAGCAGTTCGGGAAATTGAGCAGCAGATTCAGAGGGGACAGGCAATGTCAAGTTTGATGATATTGTTGTCGGTTGTGGCAGAAGCTGGTTTTTGTAACAACTTTCTGGCATCTTCTAGTATGTCTGTTGTAATCAATGGGGGCACAATTGCTGGTCTGTCACTAGGATCGTCATTGAGTACATTGAAAGCAAAGGTACATGCATTCTCTGTTTGTGATGACCCAGATTACTTCCACAACTTCACTCAAGGCTTGCTTGATGGACTCAAAGCTGGCGTTAGCTCGAGAGATATTGTCCACATTCAGAACGCCAAGGGTCTTGGCTATGCAATGAATACATCCGAGGAGCTTAATTTTGTTAAAGAAGTTGCTACGGCAACTGGTGTTGTTCATGACCCAGTATACCGTGGTAAGGCTGCTTATGCAATGGTGAAAGATATGTCTGAAAATCCAAAGAAGTGGGAAGGGAGAAAGATCCTCTTCATACATACGGGTGGCCTCCTAGGATTGTATGACAAGGTCGATCAATTGGCTTCTTTTGTTGGGAATTGGCAACGAATGGATGTCAATGAATCTGTTCCTAAGCATGATGGTATTGGAAAGATGTTCTAG
Predicted protein sequences of Glyma08g06170
>Glyma08g06170.1   sequence type=predicted peptide   gene model=Glyma08g06170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTLSLAQHHPKLKGYLLGYIEAVREIEQQIQRGQAMSSLMILLSVVAEAGFCNNFLASSSMSVVINGGTIAGLSLGSSLSTLKAKVHAFSVCDDPDYFHNFTQGLLDGLKAGVSSRDIVHIQNAKGLGYAMNTSEELNFVKEVATATGVVHDPVYRGKAAYAMVKDMSENPKKWEGRKILFIHTGGLLGLYDKVDQLASFVGNWQRMDVNESVPKHDGIGKMF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo