Glyma08g06100 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g06100

Feature Type:	gene_model
Chromosome:	Gm08
Start:	4327474
stop:	4330076
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g06100

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G68090	AT	Annotation by Michelle Graham. TAIR10: annexin 5 \| chr1:25519442-25520774 REVERSE LENGTH=316	SoyBase	E_val: 8.00E-132	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009639	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to red or far red light	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009827	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification	SoyBase	N/A	ISS
GO:0009860	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen tube growth	SoyBase	N/A	ISS
GO:0030048	GO-bp	Annotation by Michelle Graham. GO Biological Process: actin filament-based movement	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
GO:0005544	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium-dependent phospholipid binding	SoyBase	N/A	ISS
KOG0819	KOG	Annexin	JGI		ISS
PTHR10502	Panther	ANNEXIN	JGI		ISS
PTHR10502:SF10	Panther	ANNEXIN VII	JGI		ISS
PF00191	PFAM	Annexin	JGI		ISS
UniRef100_C6TNJ9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Annexin n=1 Tax=Glycine max RepID=C6TNJ9_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_UPI0001B63CD0	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0001B63CD0 related cluster n=1 Tax=unknown RepID=UPI0001B63CD0	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g06100

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g06100

Paralog	Evidence	Comments
Glyma05g33620	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g06100 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g056500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g06100

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g06100

Limit To All Plant Sequences

>Glyma08g06100.1   sequence type=CDS   gene model=Glyma08g06100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCACCTTGAATGTTCCCCCTCTTCCTCCTTCACCGAGAGACGATGCCATACAACTTTACGCTGCTTTCAAAGGATTTGGATGCGATACTAGCGTTGTGATCAATATACTTGCTCATCGAGATGCTACCCAGCGTGCCTACATCCAACAAGAATACAAAGCAATGTATTCTGGGGATCTTCTCAAACGCTTATCTTCAGAGCTTTCTGGCAAGTTGGAGACTGCACTACTGCTTTGGATGCACGACCCTGCCGGACGTGATGCAATCATCCTTAGGCAGTCTCTAACCCTGCCCAAAAATCTTGAAGCTGCCACTCAACTTATATGTTCTCGAACTCCATCCCAGCTTCATTATTTAAGACAGATTTATCATTCTAAATTTGGTGTTTATCTTGAGCATGACATTGAAACAAACACCTCCGGGGATCATAAAAAGATTTTGCTTGCATATGTAACCACACCACGTCATGAAGGCCCTGAGGTAAATAGAGAGATGGCTGAGAAGGATGCAAAGGTTCTCTACAAAGCAGGGGAGAAGAGACTGGGAACCGATGAGAAGACTTTTGTGCAAATATTCAGCGAACGGAGTGCGGCTCATTTGGCTGCTATAACTTCTTATTACCATAGCATGTATGGACACTCGTTGAAAAAGGCAGTAAAGAAGGAAACATCAGGAAATTTTGCTCTTGCACTTCTGACAATAGTTCAATGTGCTGAGAATCCTGCAAAGTATTTTGCCAAGGTCTTACGCAAGGCAATGAAAGGTTTGGGGACTGATGACACAAAACTTATAAGGGTGATAGTAACAAGGGCTGAGATTGATTTACAGTATATCAAAGCTGAATATTTAAAGAAATACAAAAAGACGCTTAACGATGCAGTTCACTCAGAAACATCCGGCCACTACAGGGCTTTTCTTCTCTCACTCTTAGGTCCCAACCAGTAG

Predicted protein sequences of Glyma08g06100

Limit To All Plant Sequences

>Glyma08g06100.1   sequence type=predicted peptide   gene model=Glyma08g06100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATLNVPPLPPSPRDDAIQLYAAFKGFGCDTSVVINILAHRDATQRAYIQQEYKAMYSGDLLKRLSSELSGKLETALLLWMHDPAGRDAIILRQSLTLPKNLEAATQLICSRTPSQLHYLRQIYHSKFGVYLEHDIETNTSGDHKKILLAYVTTPRHEGPEVNREMAEKDAKVLYKAGEKRLGTDEKTFVQIFSERSAAHLAAITSYYHSMYGHSLKKAVKKETSGNFALALLTIVQCAENPAKYFAKVLRKAMKGLGTDDTKLIRVIVTRAEIDLQYIKAEYLKKYKKTLNDAVHSETSGHYRAFLLSLLGPNQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain