SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g05750

Feature Type:gene_model
Chromosome:Gm08
Start:4101756
stop:4107809
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g05750
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G73650AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF1295) | chr1:27688549-27690165 REVERSE LENGTH=291 SoyBaseE_val: 2.00E-153ISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009813GO-bp Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process SoyBaseN/AISS
GO:0010224GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV-B SoyBaseN/AISS
GO:0031347GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0016627GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-CH group of donors SoyBaseN/AISS
KOG4650 KOG Predicted steroid reductase JGI ISS
PTHR10556Panther 3-OXO-5-ALPHA-STEROID 4-DEHYDROGENASE-RELATED JGI ISS
PTHR10556:SF24Panther SUBFAMILY NOT NAMED JGI ISS
PF06966PFAM Protein of unknown function (DUF1295) JGI ISS
UniRef100_B9DFE9UniRef Annotation by Michelle Graham. Most informative UniRef hit: AT1G73650 protein n=1 Tax=Arabidopsis thaliana RepID=B9DFE9_ARATH SoyBaseE_val: 7.00E-151ISS
UniRef100_I1KQJ7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQJ7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g05750
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g05750
ParalogEvidenceComments
Glyma05g33940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g05750 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g053000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g05750
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g05750
>Glyma08g05750.1   sequence type=CDS   gene model=Glyma08g05750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTACCGTCATCGAGTCCCATTTCTTAGCCTTCACTGCCCTTGTCACTATTGCCTATCAGTTTCTGTTTTTCGTCGTCACTGCGCTCCTCAAATTCGACAAAGTCACTGATTTTGCTGGAAGTACGAATTTCATCATAATTGCTGCATTGACCCTGGTCATCAAAGCCTCCTGGTATTTTCGACAGATAATCCTCACTTTGTTTGTTGGGACATGGGGACTTCGCCTCTGCCTTTTCCTCCTATTCAGAATTTTGCAGTGGGGAGAGGACCGGCGCTTCGATGAAATGCGTAGTAATTTGGGTAGACTGGCCATATTTTGGATATTTCAGGCTGTCTGGGTGTGGGTTGTGAGTTTACCTGTTACGTTGGTTAATGCAAGCGACAGAAATCCCTTCCTACAGGTTGTTGATATAGTAGGGTGGATTTTGTGGGCTGTGGGTTTTATTGTGGAAGGTACAGCAGATCAACAAAAGCTGCATTTCAAAAGATCTTCAGAAAATAGAGGGAAGTGGTGTAATGTTGGACTATGGAAATATTCTCGTCATCCTAACTATTTTGGTGAAATATTGCTTTGGTGGGGAATTTTTGTGGCATCTACACCTGTACTGAAGGGTGCTGAATGGCTGGTGATCATTGGACCAATCTTTCTCACATTATTGCTTCTTTTTGTCAGTGGCATTCCACTTCTTGAGGACTCAGCGGATAAGAAGTTTGGCAATGTAGATGGATATAGGATATACAAAAAGAGAACCAGCCCTTTAATCCCGTTGCCACGATCAATCTATGGGAACTTGCCCGCATGGTTCAAAACAACTTTTCTCTTCGAGTTTCCATTCTACAGTCGTAATCTACCACAAGAAGAGAACCGGTGA
Predicted protein sequences of Glyma08g05750
>Glyma08g05750.1   sequence type=predicted peptide   gene model=Glyma08g05750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGTVIESHFLAFTALVTIAYQFLFFVVTALLKFDKVTDFAGSTNFIIIAALTLVIKASWYFRQIILTLFVGTWGLRLCLFLLFRILQWGEDRRFDEMRSNLGRLAIFWIFQAVWVWVVSLPVTLVNASDRNPFLQVVDIVGWILWAVGFIVEGTADQQKLHFKRSSENRGKWCNVGLWKYSRHPNYFGEILLWWGIFVASTPVLKGAEWLVIIGPIFLTLLLLFVSGIPLLEDSADKKFGNVDGYRIYKKRTSPLIPLPRSIYGNLPAWFKTTFLFEFPFYSRNLPQEENR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo