SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g05280

Feature Type:gene_model
Chromosome:Gm08
Start:3743780
stop:3750023
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g05280
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G20000AT Annotation by Michelle Graham. TAIR10: translocase of the outer mitochondrial membrane 40 | chr3:6967685-6970247 FORWARD LENGTH=309 SoyBaseE_val: 6.00E-168ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006626GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0044070GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of anion transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005741GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial outer membrane SoyBaseN/AISS
GO:0005742GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial outer membrane translocase complex SoyBaseN/AISS
GO:0005743GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008308GO-mf Annotation by Michelle Graham. GO Molecular Function: voltage-gated anion channel activity SoyBaseN/AISS
GO:0015450GO-mf Annotation by Michelle Graham. GO Molecular Function: P-P-bond-hydrolysis-driven protein transmembrane transporter activity SoyBaseN/AISS
KOG3296 KOG Translocase of outer mitochondrial membrane complex, subunit TOM40 JGI ISS
PTHR10802Panther MITOCHONDRIAL IMPORT RECEPTOR SUBUNIT TOM40 JGI ISS
PF01459PFAM Eukaryotic porin JGI ISS
UniRef100_C5NTE6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Soybean dwarf virus resistance protein n=1 Tax=Glycine max RepID=C5NTE6_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1KQE2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQE2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g05280
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g05280
ParalogEvidenceComments
Glyma05g34360 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g05280 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g048100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g05280
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g05280
>Glyma08g05280.1   sequence type=CDS   gene model=Glyma08g05280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGACCCTCATTCCTCCCCCTCCTCCCCCTCCTCCTCCTCCTGCCGCCGCCGCCGACCCCAAGGTCGATTACTTGAACCTCCCATGTCCAATTCCCTTCGAAGAGCTCCATCGCGAAGCTATGATGTCTTTGAAGCCAGATCTTTTTGAGGGCATGCGTTTTGATTTCACCAAGATGCTCAATCAGAAGTTCTCCCTCAATCACAGCGTGTTGATGGGACCTACTGAGGTTCCTTCTCAGTCCACGGAGACTATTAAGATTCCAACTGCTCACTATGAGTTTGGCTCAACCTTCATTGATCACCCTAGGTTGTTGCTCTGGGGGAGAATTTTGACTGATGGGAGGCTCAATGCCAGAGTCAAGTGTGATTTGTCCGAAAATCTCACTTTTAAAGCCAATGCTCAGCTCACAAATGAGCCGCATATGTCTCATGCGATGATCAACTTTGATTACAAGGGAAAAGACTATAGAACCCAATTTCAACTTGGTAATGGAGCCTTGCTAGGAGCAAGTTATATTCAGAGTGTGACACAGCATTTATCATTGGGTGGGGAGGTATTTTGGGCCGGTCAGCATCGGAAGTCTGGTATTGGTTATGCTGCTCGCTACAACACTGATAAATCGGTTGCTACCGGGCAAGTTGCTAGCACTGGAATGGTTCTTCTAAGCTATGTTCAGAAGGTATCTGAGAAGGTTTCTCTAGCATCTGAGTTTATGTGCAACTACTTGTCAAGAGATGTCACAGCTAGCTTTGGTTACGACTACATCCTTAGACAGTGCCGCCTTAGGGGAAAGATTGACTCCAATGGCTGTGTTGCTGCTTTTTTGGAGGAGCGGTTAAATATGGGTCTGAATTTTATTCTTTCTGCAGAGCTTGACCACAGGAAAAAAGACTACAAATTTGGGTTTGGTTTGACCGTTGGAGAATGA
Predicted protein sequences of Glyma08g05280
>Glyma08g05280.1   sequence type=predicted peptide   gene model=Glyma08g05280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATLIPPPPPPPPPPAAAADPKVDYLNLPCPIPFEELHREAMMSLKPDLFEGMRFDFTKMLNQKFSLNHSVLMGPTEVPSQSTETIKIPTAHYEFGSTFIDHPRLLLWGRILTDGRLNARVKCDLSENLTFKANAQLTNEPHMSHAMINFDYKGKDYRTQFQLGNGALLGASYIQSVTQHLSLGGEVFWAGQHRKSGIGYAARYNTDKSVATGQVASTGMVLLSYVQKVSEKVSLASEFMCNYLSRDVTASFGYDYILRQCRLRGKIDSNGCVAAFLEERLNMGLNFILSAELDHRKKDYKFGFGLTVGE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo