Glyma08g05010 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g05010

Feature Type:	gene_model
Chromosome:	Gm08
Start:	3585102
stop:	3586045
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g05010

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G24600	AT	Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67920.1); Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). \| chr1:8720375-8720593 FORWARD LENGTH=72	SoyBase	E_val: 4.00E-10	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_E4MWN6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: mRNA, clone: RTFL01-09-C22 n=1 Tax=Eutrema halophilum RepID=E4MWN6_THEHA	SoyBase	E_val: 2.00E-08	ISS
UniRef100_I1KQB0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQB0_SOYBN	SoyBase	E_val: 2.00E-41	ISS

Expression Patterns of Glyma08g05010

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g05010

Paralog	Evidence	Comments
Glyma05g34660	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g05010 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g045300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g05010

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g05010

Limit To All Plant Sequences

>Glyma08g05010.1   sequence type=CDS   gene model=Glyma08g05010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAACAACAGCAGGAGTCCGCGAGAGGGTTGCATGGATTTTGCAGTTCACAGCCAAGTGATAAAGATTAAGGAAGAAATTGAGAAAATAAAGCACCCTTCACTTCAGCTACACATGAGGCGTGCCCTTCTCAGAGATGTCAACCGCCTCCGCTCTCGCTCACCCCTCGGATTTGCAGACAGAGAGAGAGCTATCCTTACTTAG

Predicted protein sequences of Glyma08g05010

Limit To All Plant Sequences

>Glyma08g05010.1   sequence type=predicted peptide   gene model=Glyma08g05010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENNSRSPREGCMDFAVHSQVIKIKEEIEKIKHPSLQLHMRRALLRDVNRLRSRSPLGFADRERAILT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain