Report for Sequence Feature Glyma08g04960
Feature Type: gene_model
Chromosome: Gm08
Start: 3549841
stop: 3551260
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g04960
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G18300 AT
Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48780.1); Has 69 Blast hits to 69 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:6283396-6284220 FORWARD LENGTH=274
SoyBase E_val: 1.00E-22 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1KQA5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQA5_SOYBN
SoyBase E_val: 8.00E-171 ISS
UniRef100_Q9LS60 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Gb|AAF26481.1 n=1 Tax=Arabidopsis thaliana RepID=Q9LS60_ARATH
SoyBase E_val: 6.00E-20 ISS
Expression Patterns of Glyma08g04960
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma08g04960
Paralog Evidence Comments
Glyma05g34710 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g04960 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g044800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g04960
Coding sequences of Glyma08g04960
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g04960.1 sequence type=CDS gene model=Glyma08g04960 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTGTTCTAAAATAGTTCCCCCTCGTTTCTCTTTTTCCCATGATGTCGTCTCTGAGCTACAAAAGCAACAAGATGTTCCACGCAAAGACACAATGCTTCTTGAGTCAAATCATGACTTTGAGTTCAGCACTAGCAGAAGAAGCCTTGAGTTTGAATCATCTTCTGCAGATGAGCTTTTCTCCAATGGGGTGATCGTTCCCATTCAGATGCAGAAAAAGAGAAACACTACTAGGAAACACACCCTTTATGGAGAAGCTCCATATATGAGACTTCCTCCACTTCCTTCTAGTGTTGACAAAATAAAGAAAGAGAGCACTAGAGAAGTTCTACATGATAAGAAAACTTACTCCACCTCTTTCTGGGGTTTCAGTAGAAGCAAAAGTCTCAGTTGTGATACAAAGAAAAGTTTGATGTGTTATTCACCTCCTTTGTCAAGGAGCAATTCAGCTGGTTCAGTGCCACAGCCAAAGAGAGTGAGTTCAACCGGGCATCAAGCTAAGCCACTATCATCTTCAAGCTCTTCTACCTTAAATTTGTATCCTATACAAAGGTCTCATTCAAGTAAGAGTTATGGAGGATCTTATGCCAATGGTCTTTGGATTAGTCCTGTTTTGAACCTACCAACTCCTTGCATTTCTAAAGGAAGTGGTACTAGTCTCTTCGGGTTGGGTTCTTTTTTACGTGTTGGGAAGGCCAAGAAAAGCAACAAATGA
Predicted protein sequences of Glyma08g04960
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g04960.1 sequence type=predicted peptide gene model=Glyma08g04960 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MCSKIVPPRFSFSHDVVSELQKQQDVPRKDTMLLESNHDFEFSTSRRSLEFESSSADELFSNGVIVPIQMQKKRNTTRKHTLYGEAPYMRLPPLPSSVDKIKKESTREVLHDKKTYSTSFWGFSRSKSLSCDTKKSLMCYSPPLSRSNSAGSVPQPKRVSSTGHQAKPLSSSSSSTLNLYPIQRSHSSKSYGGSYANGLWISPVLNLPTPCISKGSGTSLFGLGSFLRVGKAKKSNK*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
