SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G17190 | AT | Annotation by Michelle Graham. TAIR10: FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endomembrane system, integral to membrane, endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fung | SoyBase | E_val: 2.00E-85 | ISS |
| GO:0006007 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glucose catabolic process | SoyBase | N/A | ISS |
| GO:0006886 | GO-bp | Annotation by Michelle Graham. GO Biological Process: intracellular protein transport | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005783 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
| PF05529 | PFAM | B-cell receptor-associated protein 31-like | JGI | ISS | |
| UniRef100_I1KQ72 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQ72_SOYBN | SoyBase | E_val: 4.00E-90 | ISS |
| UniRef100_Q9FFJ0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Gb|AAF26109.1 n=1 Tax=Arabidopsis thaliana RepID=Q9FFJ0_ARATH | SoyBase | E_val: 9.00E-83 | ISS |
|
Glyma08g04740 not represented in the dataset |
Glyma08g04740 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma05g34980 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.08g042700 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma08g04740.1 sequence type=CDS gene model=Glyma08g04740 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCGCTAGAGTGGGTTGTGCTAGGGTACGTCGCGGCCGCAGAGGCCATAATGGTTATTCTCCTCACCATCCCGGGCCTGGAAGCTCTCCGAAAGGGTCTGATCGCGGTGACCCGGAACCTTCTGAAGCCGTTCCTCTCGGTGGTGCCTTTCTGCCTGTTCCTTTTCATGGACATATATTGGAAGTACGAAACCAGGCCTAGCTGTGAGGGAGATTCCTGCACCCCTTCCGAGCACCTTCGCCACCAGAAATCTATCATGAAGAGCCAACGCAACGCCCTCCTCATCGCCGCCGCACTCCTCTTCTACTGGCTCCTCTACTCCGTCACCAACCTCGTCGTCAGGATCGACCACTTGAACCAGCGTCTCGAACGCTTGAAGAATCGCGATTGA
>Glyma08g04740.1 sequence type=predicted peptide gene model=Glyma08g04740 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MALEWVVLGYVAAAEAIMVILLTIPGLEALRKGLIAVTRNLLKPFLSVVPFCLFLFMDIYWKYETRPSCEGDSCTPSEHLRHQKSIMKSQRNALLIAAALLFYWLLYSVTNLVVRIDHLNQRLERLKNRD*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
