Glyma08g03180 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g03180): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g03180): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g03180

Feature Type:	gene_model
Chromosome:	Gm08
Start:	2245245
stop:	2248654
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g03180

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G10670	AT	Annotation by Michelle Graham. TAIR10: non-intrinsic ABC protein 7 \| chr3:3335325-3337304 REVERSE LENGTH=338	SoyBase	E_val: 1.00E-128	ISS
GO:0006364	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA processing	SoyBase	N/A	ISS
GO:0006569	GO-bp	Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process	SoyBase	N/A	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0009073	GO-bp	Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process	SoyBase	N/A	ISS
GO:0009684	GO-bp	Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0009902	GO-bp	Annotation by Michelle Graham. GO Biological Process: chloroplast relocation	SoyBase	N/A	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0010207	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosystem II assembly	SoyBase	N/A	ISS
GO:0010228	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem	SoyBase	N/A	ISS
GO:0016226	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly	SoyBase	N/A	ISS
GO:0019344	GO-bp	Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process	SoyBase	N/A	ISS
GO:0019761	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process	SoyBase	N/A	ISS
GO:0034660	GO-bp	Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process	SoyBase	N/A	ISS
GO:0035304	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation	SoyBase	N/A	ISS
GO:0042793	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0048481	GO-bp	Annotation by Michelle Graham. GO Biological Process: ovule development	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016887	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
GO:0042626	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances	SoyBase	N/A	ISS
PTHR24220	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24220:SF6	Panther	SUBFAMILY NOT NAMED	JGI		ISS
UniRef100_G7LIW2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter I family member n=1 Tax=Medicago truncatula RepID=G7LIW2_MEDTR	SoyBase	E_val: 5.00E-159	ISS
UniRef100_I1KPR0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KPR0_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g03180

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g03180 not represented in the dataset	Glyma08g03180 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g03180

Paralog	Evidence	Comments
Glyma05g36400	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g03180 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g028100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g03180

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma08g03180

Limit To All Plant Sequences

>Glyma08g03180.5   sequence type=transcript   gene model=Glyma08g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TGAAAAAAGTGTATCTAAACCTTAAATTTAATTTGGATGGGTTGAAAGACTCAGACAAAACATTGAAAAGAATCAGAGCAAAAGAAAAGGGATTCTCTACGTATCAGTGCAGCGATGGCGTTATCCCTACTAATCCACTGTTCTCCCACCGTTAACCCTCTCCGACGATCCCCAAAACCCACCCTCCGCCGCGTCAACCACCGCGTCTGCGTGGCCAGCGCCGCCACTCCCCTCCTCCAAGTTAATGACTTGAGGGCCAAGATTGTCGAATCCAACGTCGACATTCTCCACGGCGTCAACCTCACCGTCAACCAAGGAGAGGTCCACGCCATCATGGGAAAAAACGGTTCCGGCAAAAGCACTTTTGCCAAGGTTCTTGTGGGGCACCCAGATTATGAAGTAACCGGAGGCAGTGTTGTTTTCAAAGGTGAGAATTTGCTTGAGATGGAACCTGAAGAAAGGTCTCTTGCGGGTCTCTTCATGAGTTTTCAATCCCCTGTTGAAATCCCCGGTGTTTCCAATGATCTATTTCTCGCCATGGCCTACAATGCTCGAATGAAAAAACTTGGTCGAGAAGAGGTTGGACCAATCGAGTTTTTACCTTACCTGATGGAGAAGCTTCAGCTTGTTAACATGAAGGCTGACTTTCTCAATAGGAATGTGAACCAAGGGTTCAGTGGCGGTGAACGCAAGCGCAATGAAATCTTGCAGCTTGCGGTTTTGGGGGCAGACTTGGCTATTTTGGATGAAATTGATTCTGGTTTGGATGTTGATGCGCTCAGGGATGTTGCCAATGCAGTTAATAGGATTCTCACCCCAGAAAAGTCCTTGTTGATGATAACTCATTATAGGCGGATTCTTGATCTTTTGAATCCTACACATGTCCATGTTATGATGGCAGTATTGCATGGGCTGGCATTCAGTAGTTGCATCTAATGGAACTTTCTTCCGCAAGGATGAGTTTGGGAAATTTGATTGTTTCACTGCTGGATGTAGTTGAATAATATCTTTGTGTGAACTGGATATAATTTCATTTTGATTATTCAACCTGCCTTAGAAGTTAGAACAAAGCATGTTTCTAGGCAACAAAATTTTGTAATTTTCTATGGCTAGAATAGCAGATGCTGACCGTAAGGATGTAGATGTGGTGTTGATTACAATTAGTGAAGTCGTTCTTGTATCCATCTATCTAATGTTTTAGCATTTTTCCTGCAGTGTTAAGAATAGGGAAGCATTTAGCAACCAAATATTCTTTTATTTGCCTAATGCTTTATAAATTCATATTGAAAGGCCTGTTCCAAATTCTGAGCATTTCATTTAATTAGTTTGATCATAAAAAATTTCAAAAGTTTTTTTAATTTAGTTTCGTACTATGGACTTACTATAGATTGCTCAGTGTTTAATGATTACTGGTAGTGGTATTGGTAAATTTATTTGACTAAGCTAAATGATGAAACTTAGTAGTTGTTTTTGGCCCTTCAAACATTGGTTGATCTTATCAAGCAGTTTAGTATCGAGTTTGGCCGAGTCATTTGTTAAAGAAAAGTTGTCATGTTGCTAGTCTAAATCTGGATTGTAATTTTAATCATATATTCCTCTGCAAGACTTGTATATTAAAATAGAGTTTCTTTTTCTGATTATCTTTTTAAGAATGGGATGTTATAATAGTATATTTCAATTAATATCGCATACTTTTGATAAAATAAAACTTTCTTAAATTTCCAGTCTGTTTGTGTTGCACCTATGTAGTGAGGCAGTTGCACTAATATGCTGATGGCTCCTTTCATCTTTTCCCTTTCTTTGTTCCATTTTGAAAACGAGGAAGCAGACTGTCTAAAGCTCATGCTGACAGAGATGTTGATGTTTCTTGACTTGGGACGTATAGTCTTCTGGGTATTATTTCCGTAGGCTTTGATAGAGAAATATCGAAACTATTGAATTTTTCCTTTTTTTTTTTTGTTTTTAATGTAAGGGCCTTTTCATTGTTAAATATCAACTTGGGGCACACATGCCTCGTTTGCTGTAAATGCAGTAAGGATTGAAATAGCTGTCAAACTACATTAATATTAGCCACATTTTTGTTTTGGTATTGGCAGTTGGCCTAGCCTTTTCATGGGCATATTAAAAAACTTTAAATTATTGCTTTTAGAATATTCATCTATACACGTGATTTCAAAATATT

Coding sequences of Glyma08g03180

Limit To All Plant Sequences

>Glyma08g03180.4   sequence type=CDS   gene model=Glyma08g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTTATCCCTACTAATCCACTGTTCTCCCACCGTTAACCCTCTCCGACGATCCCCAAAACCCACCCTCCGCCGCGTCAACCACCGCGTCTGCGTGGCCAGCGCCGCCACTCCCCTCCTCCAAGTTAATGACTTGAGGGCCAAGATTGTCGAATCCAACGTCGACATTCTCCACGGCGTCAACCTCACCGTCAACCAAGGAGAGGTCCACGCCATCATGGGAAAAAACGGTTCCGGCAAAAGCACTTTTGCCAAGGTTCTTGTGGGGCACCCAGATTATGAAGTAACCGGAGGCAGTGTTGTTTTCAAAGGTGAGAATTTGCTTGAGATGGAACCTGAAGAAAGGTCTCTTGCGGGTCTCTTCATGAGTTTTCAATCCCCTGTTGAAATCCCCGGTGTTTCCAATGATCTATTTCTCGCCATGGCCTACAATGCTCGAATGAAAAAACTTGGTCGAGAAGAGGTTGGACCAATCGAGTTTTTACCTTACCTGATGGAGAAGCTTCAGCTTGTTAACATGAAGGCTGACTTTCTCAATAGGAATGTGAACCAAGGGTTCAGTGGCGGTGAACGCAAGCGCAATGAAATCTTGCAGCTTGCGGTTTTGGGGGCAGACTTGGCTATTTTGGATGAAATTGATTCTGGTTTGGATGTTGATGCGCTCAGGGATGTTGCCAATGCAGTTAATAGGATTCTCACCCCAGAAAAGTCCTTGTTGATGATAACTCATTATAGGCGGATTCTTGATCTTTTGAATCCTACACATGTCCATGTTATGGACAAAGGGAAAATTGCAAGGTCAGGCGACATATCGATGGTAGAAGCTATTGAGGCTGATGGATATGAAACAGTCTCTGCTTTAACATAA

>Glyma08g03180.5   sequence type=CDS   gene model=Glyma08g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTTATCCCTACTAATCCACTGTTCTCCCACCGTTAACCCTCTCCGACGATCCCCAAAACCCACCCTCCGCCGCGTCAACCACCGCGTCTGCGTGGCCAGCGCCGCCACTCCCCTCCTCCAAGTTAATGACTTGAGGGCCAAGATTGTCGAATCCAACGTCGACATTCTCCACGGCGTCAACCTCACCGTCAACCAAGGAGAGGTCCACGCCATCATGGGAAAAAACGGTTCCGGCAAAAGCACTTTTGCCAAGGTTCTTGTGGGGCACCCAGATTATGAAGTAACCGGAGGCAGTGTTGTTTTCAAAGGTGAGAATTTGCTTGAGATGGAACCTGAAGAAAGGTCTCTTGCGGGTCTCTTCATGAGTTTTCAATCCCCTGTTGAAATCCCCGGTGTTTCCAATGATCTATTTCTCGCCATGGCCTACAATGCTCGAATGAAAAAACTTGGTCGAGAAGAGGTTGGACCAATCGAGTTTTTACCTTACCTGATGGAGAAGCTTCAGCTTGTTAACATGAAGGCTGACTTTCTCAATAGGAATGTGAACCAAGGGTTCAGTGGCGGTGAACGCAAGCGCAATGAAATCTTGCAGCTTGCGGTTTTGGGGGCAGACTTGGCTATTTTGGATGAAATTGATTCTGGTTTGGATGTTGATGCGCTCAGGGATGTTGCCAATGCAGTTAATAGGATTCTCACCCCAGAAAAGTCCTTGTTGATGATAACTCATTATAGGCGGATTCTTGATCTTTTGAATCCTACACATGTCCATGTTATGATGGCAGTATTGCATGGGCTGGCATTCAGTAGTTGCATCTAA

Predicted protein sequences of Glyma08g03180

Limit To All Plant Sequences

>Glyma08g03180.4   sequence type=predicted peptide   gene model=Glyma08g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALSLLIHCSPTVNPLRRSPKPTLRRVNHRVCVASAATPLLQVNDLRAKIVESNVDILHGVNLTVNQGEVHAIMGKNGSGKSTFAKVLVGHPDYEVTGGSVVFKGENLLEMEPEERSLAGLFMSFQSPVEIPGVSNDLFLAMAYNARMKKLGREEVGPIEFLPYLMEKLQLVNMKADFLNRNVNQGFSGGERKRNEILQLAVLGADLAILDEIDSGLDVDALRDVANAVNRILTPEKSLLMITHYRRILDLLNPTHVHVMDKGKIARSGDISMVEAIEADGYETVSALT*

>Glyma08g03180.5   sequence type=predicted peptide   gene model=Glyma08g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALSLLIHCSPTVNPLRRSPKPTLRRVNHRVCVASAATPLLQVNDLRAKIVESNVDILHGVNLTVNQGEVHAIMGKNGSGKSTFAKVLVGHPDYEVTGGSVVFKGENLLEMEPEERSLAGLFMSFQSPVEIPGVSNDLFLAMAYNARMKKLGREEVGPIEFLPYLMEKLQLVNMKADFLNRNVNQGFSGGERKRNEILQLAVLGADLAILDEIDSGLDVDALRDVANAVNRILTPEKSLLMITHYRRILDLLNPTHVHVMMAVLHGLAFSSCI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain