SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g02460

Feature Type:gene_model
Chromosome:Gm08
Start:1693008
stop:1694851
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G23750AT Annotation by Michelle Graham. TAIR10: cytokinin response factor 2 | chr4:12376751-12377782 FORWARD LENGTH=343 SoyBaseE_val: 2.00E-53ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006606GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus SoyBaseN/AISS
GO:0042991GO-bp Annotation by Michelle Graham. GO Biological Process: transcription factor import into nucleus SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0042802GO-mf Annotation by Michelle Graham. GO Molecular Function: identical protein binding SoyBaseN/AISS
PF00847PFAM AP2 domain JGI ISS
UniRef100_B9RCN4UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA binding protein, putative n=1 Tax=Ricinus communis RepID=B9RCN4_RICCO SoyBaseE_val: 6.00E-62ISS
UniRef100_I1KPI0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KPI0_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma05g37120 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g020900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g02460.1   sequence type=CDS   gene model=Glyma08g02460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCATCTTCCATCAAACACACTCACCACCTTAACCGCACAAAACTCTTCATGAAAGAAGAAACCCTTTTGAAAAAGAAGCATCACTATCCCAAAATCATACGAATACGTGTCACCGACGCCGACGCTACCGACTCCTCCAGCGACGACGACGAGCCCTCCATGTCCTCCACGCGCCGCAGAGTAAAAAACTTCGTCAACGAAATTACCATCCAAGGCGGCGGCGGTGGTGGTGGCGACGTTAACGTTGTTTCTAAGAAAAGAAGATTCAAGTCCGGTGCCGGAGCTCCGTTATGTCGGCGGAAGACGGGGGCGAAGAAGTTCCGGGGAGTGAGGCAGCGGCCATGGGGGAAGTGGGCGGCGGAGATAAGAGACCCGTCGCGCCGCGTCCGGCTGTGGCTGGGAACCTACGACACCGCCGAGGAAGCTGCCATTGTGTACGACAACGCGGCCATTCAGCTGCGTGGCGCCGACGCGCTCACCAATTTCATAACGCCGCCGCCGGAGAACAGAAAAACCGGTTACTGCTCCGGCGAGGAGTCTCGCAACAACGACGACTTGCGTTCCCCCACTTCGGTTCTTGGGCGCTGTTCGGTGTCCGAGGAAGCTGTAACTGCAAACGACGTATTTGGAGGCTCTAGTGAGTGCGAGTATTCATGCGTTTCGGAGTCAGTGTTTCCTATTCCTAACGAGGTGGTGTTTGACTTTGAAAGCACGTTAGATATGTTTGATGAAGGGATTAATAATGTTGTGGCAGAGACTAGTATATTCTTGGCGGAGGATTTAGATTTGGGTTTTACGAGTTGGCATAGAGAGTGTGATAATTTCCAAGACATTGGGGGGGATTTGTTTGTTTGGGATCCTCTTGTCGCTCTTTGA

>Glyma08g02460.1   sequence type=predicted peptide   gene model=Glyma08g02460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSSIKHTHHLNRTKLFMKEETLLKKKHHYPKIIRIRVTDADATDSSSDDDEPSMSSTRRRVKNFVNEITIQGGGGGGGDVNVVSKKRRFKSGAGAPLCRRKTGAKKFRGVRQRPWGKWAAEIRDPSRRVRLWLGTYDTAEEAAIVYDNAAIQLRGADALTNFITPPPENRKTGYCSGEESRNNDDLRSPTSVLGRCSVSEEAVTANDVFGGSSECEYSCVSESVFPIPNEVVFDFESTLDMFDEGINNVVAETSIFLAEDLDLGFTSWHRECDNFQDIGGDLFVWDPLVAL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo