SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g01460): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g01460): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g01460

Feature Type:gene_model
Chromosome:Gm08
Start:924775
stop:928016
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48680AT Annotation by Michelle Graham. TAIR10: gamma carbonic anhydrase-like 2 | chr3:18035107-18036773 FORWARD LENGTH=256 SoyBaseE_val: 1.00E-139ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005747GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex I SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0031966GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial membrane SoyBaseN/AISS
GO:0045271GO-cc Annotation by Michelle Graham. GO Cellular Compartment: respiratory chain complex I SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG3121 KOG Dynactin, subunit p25 JGI ISS
PTHR13061Panther DYNACTIN SUBUNIT P25 JGI ISS
UniRef100_B9RAD6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein yrdA, putative n=1 Tax=Ricinus communis RepID=B9RAD6_RICCO SoyBaseE_val: 2.00E-146ISS
UniRef100_I1KP69UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KP69_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g01460 not represented in the dataset

Glyma08g01460 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma05g38160 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g011600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g01460.1   sequence type=CDS   gene model=Glyma08g01460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAATCTAGCACGCTTCTCCAAGAGAGCCCTAAGAAGCGCACACGCGCTAGCAAGGCCCCACGTGCAGCCTCAGCTGCTGACAGCAGAACGCGCTTTTTCGACGGATGCGCCGACATCGATTACCCCGTCGGCGGATCGCGTGAAGTGGGACTACCGTGGGCAGAGGAAGATAATCCCGTTGGGGCAGTGGCTCCCCAAAGTTGCCGTGGATGCTTACGTGGCACCCAACGTGGTCCTCGCCGGCCAAGTCACCGTCTGGGACGGAGCCTCCGTCTGGCCCGGTTGCGTCCTCCGCGGCGATCTCAACAAGATCAGCATCGGATTCTGCTCCAACGTCCAGGAACGCTCCGTTCTTCACGCGGCTTGGTCCTCTCCCACAGGCCTTCCAGCTGACACTTCAATAGAGAGGTACGTGACAATTGGAGCATACAGCCTGTTGAGGTCCTGCACTATTGAGCCAGAGTGCATTATTGGGCAGCATTCCATCCTCATGGAAGGTTCATTGGTGGAGACGCAGTCAATCCTTGAAGCTGGGTCAGTAGTTCCACCAGGGAGGCGAATTCCAACCGGTGAACTTTGGGCAGGAAATCCAGCCAGGTATGTGAGGACTTTGACCCATGAAGAAATCTTAGAAATCCCCAAACTTGCAGTTGCTATAAACGATCTGAGCAGAGACCATTACTCAGAGTTCCTTCCTTATTCCACCGTATATTTGGAGGTTGAGAAGTTTAAGAAGTCTTTGGGTATTTCTGTTTGA

>Glyma08g01460.1   sequence type=predicted peptide   gene model=Glyma08g01460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANLARFSKRALRSAHALARPHVQPQLLTAERAFSTDAPTSITPSADRVKWDYRGQRKIIPLGQWLPKVAVDAYVAPNVVLAGQVTVWDGASVWPGCVLRGDLNKISIGFCSNVQERSVLHAAWSSPTGLPADTSIERYVTIGAYSLLRSCTIEPECIIGQHSILMEGSLVETQSILEAGSVVPPGRRIPTGELWAGNPARYVRTLTHEEILEIPKLAVAINDLSRDHYSEFLPYSTVYLEVEKFKKSLGISV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo