Report for Sequence Feature Glyma07g39350
Feature Type: gene_model
Chromosome: Gm07
Start: 43843748
stop: 43849320
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma07g39350
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G62360 AT
Annotation by Michelle Graham. TAIR10: KNOX/ELK homeobox transcription factor | chr1:23058796-23061722 REVERSE LENGTH=382
SoyBase E_val: 8.00E-129 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0007389 GO-bp
Annotation by Michelle Graham. GO Biological Process: pattern specification process
SoyBase N/A ISS
GO:0009691 GO-bp
Annotation by Michelle Graham. GO Biological Process: cytokinin biosynthetic process
SoyBase N/A ISS
GO:0009855 GO-bp
Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry
SoyBase N/A ISS
GO:0009886 GO-bp
Annotation by Michelle Graham. GO Biological Process: post-embryonic morphogenesis
SoyBase N/A ISS
GO:0009887 GO-bp
Annotation by Michelle Graham. GO Biological Process: organ morphogenesis
SoyBase N/A ISS
GO:0009909 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of flower development
SoyBase N/A ISS
GO:0009934 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of meristem structural organization
SoyBase N/A ISS
GO:0010051 GO-bp
Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation
SoyBase N/A ISS
GO:0010093 GO-bp
Annotation by Michelle Graham. GO Biological Process: specification of floral organ identity
SoyBase N/A ISS
GO:0019827 GO-bp
Annotation by Michelle Graham. GO Biological Process: stem cell maintenance
SoyBase N/A ISS
GO:0048438 GO-bp
Annotation by Michelle Graham. GO Biological Process: floral whorl development
SoyBase N/A ISS
GO:0048439 GO-bp
Annotation by Michelle Graham. GO Biological Process: flower morphogenesis
SoyBase N/A ISS
GO:0048440 GO-bp
Annotation by Michelle Graham. GO Biological Process: carpel development
SoyBase N/A ISS
GO:0048481 GO-bp
Annotation by Michelle Graham. GO Biological Process: ovule development
SoyBase N/A ISS
GO:0048507 GO-bp
Annotation by Michelle Graham. GO Biological Process: meristem development
SoyBase N/A ISS
GO:0048513 GO-bp
Annotation by Michelle Graham. GO Biological Process: organ development
SoyBase N/A ISS
GO:0048519 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0043565 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding
SoyBase N/A ISS
KOG0773
KOG
Transcription factor MEIS1 and related HOX domain proteins
JGI ISS
PTHR11850 Panther
HOMEOBOX PROTEIN
JGI ISS
PTHR11850:SF48 Panther
HOMEOBOX PROTEIN MEIS3
JGI ISS
PF00046 PFAM
Homeobox domain
JGI ISS
PF03789 PFAM
ELK domain
JGI ISS
PF03790 PFAM
KNOX1 domain
JGI ISS
PF03791 PFAM
KNOX2 domain
JGI ISS
UniRef100_A7J0W0 UniRef
Annotation by Michelle Graham. Best UniRef hit: KNT1 n=2 Tax=Glycine max RepID=A7J0W0_SOYBN
SoyBase E_val: 0 ISS
UniRef100_A7J0W0 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: KNT1 n=2 Tax=Glycine max RepID=A7J0W0_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma07g39350
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma07g39350
Paralog Evidence Comments
Glyma17g01370 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma07g39350 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.07g263600 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma07g39350
Coding sequences of Glyma07g39350
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma07g39350.1 sequence type=CDS gene model=Glyma07g39350 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGTGAGGAGGCAATGGAGGGTGTAATTTCTTCTAAAGGGATGGGTTTTGGAGAGAATACAAGTAGTAGTGGGGTTTGTCCAATGATGATGATGCCTTTAGTGACTTCTCATCATGTTGGTCATCATCCATTAAATCATCCTATTCTTAATAATCCCAATCCTAATGAACACACAAACACTCTCTTCCTTCCCATGCCTTGTACTAATAATAATCACCACCCGAACCGCAATAACCACAACTCCAACGCCACTGAGTTAGGGTATTTCATGGAGATCCCCAACAACAACAACGATGGAAGCTCCTCTTCCCCTTCTTCAGCTGTCAAGGCCAAGATCATGGCCCATCCTCACTATCACCGTCTCTTGGCAGCCTACGTCAATTGTCAAAAGGTTGGGGCTCCGCCTGAAGTGGTGGGAAGGTTAGAAGAAGCATGTGCATCTGCTGCAGTGATAATGGCAGGTGGAACAGCCAGCATAGGCGAGGATCCAGCGCTGGATCAGTTCATGGAGGCTTACTGTGAGATGCTGATCAAGTACGAGCAAGAGCTCTCCAAACCCTTCAAGGAAGCCATGCTCTTTCTTCAGAGGATCGAGTGCCAGTTCAAATCTCTCACTATTTCTTCTTCTTTGGACACTACTGCGTGTAATGAAGCTATTGATAGGAATGGGCCATCTGAAGATGTTGATGTTCAGACCAACATAATAGATCCGCAGGCAGAGGACCAAGAACTGAAAGGTCAACTCTTACGCAAGTACCGTGGATACCTAGGCAGTTTGAAACAGGAATTCACCAAGAAGAGAAAAAAGGGCAAGCTGCCCAAAGAAGCAAGGCAACAATTACTTGAATGGTGGAGCAGACACTACAAATGGCCTTACCCATCTGAATCTCAGAAGCTGGCTCTTGCAGAGTCAACAGGCCTGGATCAGAAGCAAATTAACAACTGGTTTATCAATCAAAGGAAGAGGCACTGGAAGCCTTCAGAGGACATGCAATTTGTGGTGGTGGATCCAAGCCATCCACACTACTACATGGAAAATGTTCTGGGCAATCCCTTTCCCATGGATCTCTCCCACCCAATGCTCTAA
Predicted protein sequences of Glyma07g39350
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma07g39350.1 sequence type=predicted peptide gene model=Glyma07g39350 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGEEAMEGVISSKGMGFGENTSSSGVCPMMMMPLVTSHHVGHHPLNHPILNNPNPNEHTNTLFLPMPCTNNNHHPNRNNHNSNATELGYFMEIPNNNNDGSSSSPSSAVKAKIMAHPHYHRLLAAYVNCQKVGAPPEVVGRLEEACASAAVIMAGGTASIGEDPALDQFMEAYCEMLIKYEQELSKPFKEAMLFLQRIECQFKSLTISSSLDTTACNEAIDRNGPSEDVDVQTNIIDPQAEDQELKGQLLRKYRGYLGSLKQEFTKKRKKGKLPKEARQQLLEWWSRHYKWPYPSESQKLALAESTGLDQKQINNWFINQRKRHWKPSEDMQFVVVDPSHPHYYMENVLGNPFPMDLSHPML*