SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g38480

Feature Type:gene_model
Chromosome:Gm07
Start:43201921
stop:43203708
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g38480
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G31710AT Annotation by Michelle Graham. TAIR10: Copper amine oxidase family protein | chr1:11349855-11355339 FORWARD LENGTH=681 SoyBaseE_val: 4.00E-50ISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0009308GO-bp Annotation by Michelle Graham. GO Biological Process: amine metabolic process SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0008131GO-mf Annotation by Michelle Graham. GO Molecular Function: primary amine oxidase activity SoyBaseN/AISS
GO:0048038GO-mf Annotation by Michelle Graham. GO Molecular Function: quinone binding SoyBaseN/AISS
PTHR10638Panther COPPER/TOPAQUINONE OXIDASE JGI ISS
PTHR10638:SF12Panther COPPER AMINE OXIDASE JGI ISS
PF01179PFAM Copper amine oxidase, enzyme domain JGI ISS
UniRef100_I1MRA7UniRef Annotation by Michelle Graham. Best UniRef hit: Amine oxidase n=1 Tax=Glycine max RepID=I1MRA7_SOYBN SoyBaseE_val: 2.00E-98ISS
UniRef100_I1MRA7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Amine oxidase n=1 Tax=Glycine max RepID=I1MRA7_SOYBN SoyBaseE_val: 2.00E-98ISS

Expression Patterns of Glyma07g38480
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g38480
ParalogEvidenceComments
Glyma17g02260 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g38480 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g255000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g38480
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g38480
>Glyma07g38480.1   sequence type=CDS   gene model=Glyma07g38480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGGCGTCACACAGAAACAGGCATTCCCAATGAATCGTTCGCCGAAACTAGAATGGAAGTGAACTTAGTGCTAAGAACAGTTGTTACTGTGGGCAACTACGACAATTGGGAGTTTAAAACAAGTGCCTCAATCAAGCCCTCGGAAATATTGCTCTCTCGGGTATATTGGAAATTAAGGGAGTGGACATTAAGCACAAGAGTGAGATCAAGAGCGATCGACATGGAACCTTGGTGTCAGCAAACAGCATTGGTGTTTACCACGACCACTTCTACATTTACCATCTCTTTTGAGAAGACAAGTTTGAAGACAGTAAGAGTGACAGATGGAAGTTCGAAGAGAAAAAGCTATTGGACAACTGAGCCTAACAAGAAAACCTCCGTTGGATCACAAATACGTGGCGCTTTTACCAACTTCAATGTTTGGGTCACTCCATACAATAGGACTGAGGACCATGGAGATGATACTTTGGCCGTTTGGACCAAAAAGAATAGAGACATTAACAACAAGGACATTGTGCTGTGGCACGTTGTGGGAATTCATCATGTTCCAGCACAAGAAAACTTCCCCATAATGCCATTATTGAGCACTGCATTCGAGCTCAGGCCAACCAATTTCTTCGAGAGGAATCCGGTTCTTAAAACCCTTTCTCCCAAGGATGTGCAATGGCCCGGTTGCCCCAAGTGA
Predicted protein sequences of Glyma07g38480
>Glyma07g38480.1   sequence type=predicted peptide   gene model=Glyma07g38480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MWRHTETGIPNESFAETRMEVNLVLRTVVTVGNYDNWEFKTSASIKPSEILLSRVYWKLREWTLSTRVRSRAIDMEPWCQQTALVFTTTTSTFTISFEKTSLKTVRVTDGSSKRKSYWTTEPNKKTSVGSQIRGAFTNFNVWVTPYNRTEDHGDDTLAVWTKKNRDINNKDIVLWHVVGIHHVPAQENFPIMPLLSTAFELRPTNFFERNPVLKTLSPKDVQWPGCPK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo