Glyma07g36760 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g36760

Feature Type:	gene_model
Chromosome:	Gm07
Start:	42066875
stop:	42067849
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g36760

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G16920	AT	Annotation by Michelle Graham. TAIR10: ubiquitin-conjugating enzyme 23 \| chr2:7334559-7338827 REVERSE LENGTH=1102	SoyBase	E_val: 3.00E-84	ISS
GO:0006301	GO-bp	Annotation by Michelle Graham. GO Biological Process: postreplication repair	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0004842	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity	SoyBase	N/A	ISS
GO:0016881	GO-mf	Annotation by Michelle Graham. GO Molecular Function: acid-amino acid ligase activity	SoyBase	N/A	ISS
KOG0417	KOG	Ubiquitin-protein ligase	JGI		ISS
PTHR24067	Panther	UBIQUITIN-CONJUGATING ENZYME E2	JGI		ISS
PTHR24067:SF12	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00179	PFAM	Ubiquitin-conjugating enzyme	JGI		ISS
UniRef100_Q2HSL7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin-conjugating enzyme, E2 n=1 Tax=Medicago truncatula RepID=Q2HSL7_MEDTR	SoyBase	E_val: 2.00E-120	ISS
UniRef100_UPI0002338BEF	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002338BEF related cluster n=1 Tax=unknown RepID=UPI0002338BEF	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma07g36760

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g36760

Paralog	Evidence	Comments
Glyma17g03790	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g36760 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g239100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g36760

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g36760

Limit To All Plant Sequences

>Glyma07g36760.2   sequence type=CDS   gene model=Glyma07g36760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAATACGAACGGGTTCGTGCACTTTGATGTGGTTTCAGATGATGCAGATCACCACTTTCTGGGTTCAAATAAAGGAAAATGCTTCACAGATTTAAAGAGTGAAGTGTACCGCACCATCATGAAAGAGTGGAAAATCCTGGAGCAGAATTTACCGGAATCCATATACGTGCGGGTCTACGAACGACGCATTGATCTAATGAGAGCCGTGATCGTAGGTGCCGCCGGCACACCGTACCACGATGGTCTGTTCTTCTTCGACATAGGGTTCCCCTCCGATTACCCGAAAAATCCCCCAAAGCTGCATTACCACTCGTTCGGCTACAGACACAACCCAAATCTCTACTCCAGCGGAAGAGTGTGCTTGAGCCTTCTGAACACGTGGACAGGGAGAAAGAGTGAGAAGTGGGACCCATCTGGGTCCACGATGCTCCAAGTGTTGCTCTCTATCCAAGCACTGGTTCTCAACAAGAAGCCATATTATAACGAGCCTGGACTGGCTAGTATTGCGTCCTCCGAGTGGAGGTCACGTGCCTACAACGAGAACGTCTTTCTTATTACTTGCAGCACCTCCCTTCATCTGCTTCGGAGGCCTCCCTTCAACTTTGAAGCATTTGTCAGTGCCCATTTTCGCCAGCGCGCGTTTCGGATTCTCTCGGCATGCAGCGACTACACGAATGGGCGCGCGAGGGTTGGCCATTACTCTTTTGACTTGCGTCTGTCTTCTTCTTCGTCAAAGCTACATGTTTCACGGAGTTTTAAAAAGCAGATGATAGCGTTTTACCCTCGGCTTCTTCAAGCATTTCGACAGAATGGAGCTTCTTTGGAGGGTTTCGCCGAACATTTGGAGCTCGAGAGTAAGCATTCCGAAAACAAAAGCGGTGGAATCTTCAAGAAGGTCATGGAAAAGATCAAAAAGGCTTTCGGATTGAAGAAAAACAAAGGACAACAAAGTCGTCTTGAAAGTGCTTAA

Predicted protein sequences of Glyma07g36760

Limit To All Plant Sequences

>Glyma07g36760.2   sequence type=predicted peptide   gene model=Glyma07g36760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENTNGFVHFDVVSDDADHHFLGSNKGKCFTDLKSEVYRTIMKEWKILEQNLPESIYVRVYERRIDLMRAVIVGAAGTPYHDGLFFFDIGFPSDYPKNPPKLHYHSFGYRHNPNLYSSGRVCLSLLNTWTGRKSEKWDPSGSTMLQVLLSIQALVLNKKPYYNEPGLASIASSEWRSRAYNENVFLITCSTSLHLLRRPPFNFEAFVSAHFRQRAFRILSACSDYTNGRARVGHYSFDLRLSSSSSKLHVSRSFKKQMIAFYPRLLQAFRQNGASLEGFAEHLELESKHSENKSGGIFKKVMEKIKKAFGLKKNKGQQSRLESA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain