Report for Sequence Feature Glyma07g33870
Feature Type: gene_model
Chromosome: Gm07
Start: 38809017
stop: 38813856
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma07g33870
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G36910 AT
Annotation by Michelle Graham. TAIR10: Cystathionine beta-synthase (CBS) family protein | chr4:17391016-17393218 REVERSE LENGTH=236
SoyBase E_val: 1.00E-86 ISS
GO:0045454 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PTHR11911 Panther
INOSINE-5-MONOPHOSPHATE DEHYDROGENASE RELATED
JGI ISS
PF00571 PFAM
CBS domain
JGI ISS
UniRef100_I1KM26 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KM26_SOYBN
SoyBase E_val: 5.00E-160 ISS
UniRef100_O23193 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: CBS domain-containing protein CBSX1, chloroplastic n=1 Tax=Arabidopsis thaliana RepID=CBSX1_ARATH
SoyBase E_val: 5.00E-84 ISS
Expression Patterns of Glyma07g33870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma07g33870
Paralog Evidence Comments
Glyma02g11600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma07g33870 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.07g215400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma07g33870
Coding sequences of Glyma07g33870
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma07g33870.1 sequence type=CDS gene model=Glyma07g33870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACTTCGATTCATTTGATAAACACTCTCGCTGCTCCGCTTCGTTCTTTTTCTCCTCCGTCGCTTTTTCCGCAATGCCATTCTCCTCTCCGTTCTTCCGCTGCCCCGAAACGGCGTCGTTTCGCTAACTCCTCTGGGTTCCGCCTTGCTTCAAGCCAAACCGTGAATTCGGTTCCGCGTGGGAATGGAACTTACACCGTTGCTGATTTCATGACAAAGAAGCAAGATTTGCATGTTGTCAAAACCACCACTACCGTTGATGAAGCTCTGGAGGCTCTTGTAAACTACAGAATCAGTGGTCTTCCGGTAATCGATGAGGTCTGGAATCTGGTTGGAGTTGTATCTGATTATGACTTGTTAGCTATTGATTCGATATCAGGAGGTCCTCAAAGTGATGCAAACTTGTTCCCCAATGTTGATAGTACTTGGAAAACATTCAATGAGTTACAAAAACTGCTTAGTAAGACTAATGGCCAAGTTGTCGGTGACTTGATGACTCCAACTCCACTTGTTGTTCATGAATCAACTAGTCTTGAGGAAGCTGCTAGGCTGTTACTTGAAACAAAATATCGTCGACTACCTGTGGTAGATGATGATGGAAAGCTGGTTGGACTTATTACACGGGGAAACATTGTTAAGGCAGCTCTACTATCAAAACGTGCTGGATAG
Predicted protein sequences of Glyma07g33870
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma07g33870.1 sequence type=predicted peptide gene model=Glyma07g33870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTSIHLINTLAAPLRSFSPPSLFPQCHSPLRSSAAPKRRRFANSSGFRLASSQTVNSVPRGNGTYTVADFMTKKQDLHVVKTTTTVDEALEALVNYRISGLPVIDEVWNLVGVVSDYDLLAIDSISGGPQSDANLFPNVDSTWKTFNELQKLLSKTNGQVVGDLMTPTPLVVHESTSLEEAARLLLETKYRRLPVVDDDGKLVGLITRGNIVKAALLSKRAG*