SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g33870

Feature Type:gene_model
Chromosome:Gm07
Start:38809017
stop:38813856
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g33870
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G36910AT Annotation by Michelle Graham. TAIR10: Cystathionine beta-synthase (CBS) family protein | chr4:17391016-17393218 REVERSE LENGTH=236 SoyBaseE_val: 1.00E-86ISS
GO:0045454GO-bp Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR11911Panther INOSINE-5-MONOPHOSPHATE DEHYDROGENASE RELATED JGI ISS
PF00571PFAM CBS domain JGI ISS
UniRef100_I1KM26UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KM26_SOYBN SoyBaseE_val: 5.00E-160ISS
UniRef100_O23193UniRef Annotation by Michelle Graham. Most informative UniRef hit: CBS domain-containing protein CBSX1, chloroplastic n=1 Tax=Arabidopsis thaliana RepID=CBSX1_ARATH SoyBaseE_val: 5.00E-84ISS

Expression Patterns of Glyma07g33870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g33870
ParalogEvidenceComments
Glyma02g11600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g33870 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g215400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g33870
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g33870
>Glyma07g33870.1   sequence type=CDS   gene model=Glyma07g33870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTTCGATTCATTTGATAAACACTCTCGCTGCTCCGCTTCGTTCTTTTTCTCCTCCGTCGCTTTTTCCGCAATGCCATTCTCCTCTCCGTTCTTCCGCTGCCCCGAAACGGCGTCGTTTCGCTAACTCCTCTGGGTTCCGCCTTGCTTCAAGCCAAACCGTGAATTCGGTTCCGCGTGGGAATGGAACTTACACCGTTGCTGATTTCATGACAAAGAAGCAAGATTTGCATGTTGTCAAAACCACCACTACCGTTGATGAAGCTCTGGAGGCTCTTGTAAACTACAGAATCAGTGGTCTTCCGGTAATCGATGAGGTCTGGAATCTGGTTGGAGTTGTATCTGATTATGACTTGTTAGCTATTGATTCGATATCAGGAGGTCCTCAAAGTGATGCAAACTTGTTCCCCAATGTTGATAGTACTTGGAAAACATTCAATGAGTTACAAAAACTGCTTAGTAAGACTAATGGCCAAGTTGTCGGTGACTTGATGACTCCAACTCCACTTGTTGTTCATGAATCAACTAGTCTTGAGGAAGCTGCTAGGCTGTTACTTGAAACAAAATATCGTCGACTACCTGTGGTAGATGATGATGGAAAGCTGGTTGGACTTATTACACGGGGAAACATTGTTAAGGCAGCTCTACTATCAAAACGTGCTGGATAG
Predicted protein sequences of Glyma07g33870
>Glyma07g33870.1   sequence type=predicted peptide   gene model=Glyma07g33870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTSIHLINTLAAPLRSFSPPSLFPQCHSPLRSSAAPKRRRFANSSGFRLASSQTVNSVPRGNGTYTVADFMTKKQDLHVVKTTTTVDEALEALVNYRISGLPVIDEVWNLVGVVSDYDLLAIDSISGGPQSDANLFPNVDSTWKTFNELQKLLSKTNGQVVGDLMTPTPLVVHESTSLEEAARLLLETKYRRLPVVDDDGKLVGLITRGNIVKAALLSKRAG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo