SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g31830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g31830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g31830

Feature Type:gene_model
Chromosome:Gm07
Start:36800921
stop:36803437
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G33800AT Annotation by Michelle Graham. TAIR10: Ribosomal protein S5 family protein | chr2:14300925-14302352 REVERSE LENGTH=303 SoyBaseE_val: 1.00E-141ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0045036GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to chloroplast SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG0877 KOG 40S ribosomal protein S2/30S ribosomal protein S5 JGI ISS
PTHR13718Panther RIBOSOMAL S SUBUNIT JGI ISS
PTHR13718:SF55Panther SUBFAMILY NOT NAMED JGI ISS
PF00333PFAM Ribosomal protein S5, N-terminal domain JGI ISS
PF03719PFAM Ribosomal protein S5, C-terminal domain JGI ISS
UniRef100_B9RBC3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 30S ribosomal protein S5, putative n=1 Tax=Ricinus communis RepID=B9RBC3_RICCO SoyBaseE_val: 4.00E-154ISS
UniRef100_I1KLL8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KLL8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g31830 not represented in the dataset

Glyma07g31830 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g24640 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g198500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g31830.1   sequence type=CDS   gene model=Glyma07g31830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCGCACCTTCCCTCTCCTCCGCTCTCAACTCCCTCTCCTCTCTATCCCTCTCCACCTCCTCCCGCTTCTCTCTCCTCCCTCCACCCTCCCTCCTCTCCAAACCTCTCCCCCTCCTCTTCGCAACCACCACCCTCAAATCCAAACCCTCCGACGACATTGACACATCGTTCTTCGACAACATCAACCCGCAAGACGACATCACATTCAACCCTCCGGAGCCCCCGGAGGGCTTCGTGGCGCCTCCGTCCTTCGACGACGGCCCCCTGGAGACTGAGGACGAAATCGCCGCAGCCTACGAGGAGCTCTACGGCCCCGGCTACAGCGGCGTCTCGGTCCTCGGCAACGACGTGTACGTGATGGACGCGAAGGTGAAGAAGGAGACCGGGTTCGGGTCCGGCGCTAAGAAGGAGAAGGTGAGGGATGGGTTCGAGGAGAGGGTGGTGCAGGTCAGGAGGGTCACCAAGGTCGTCAAGGGAGGGAAGCAGCTCAGGTTTCGGGCCGTCGTTGTCGTCGGCGACAAGAAGGGCTCAGTGGGCGTCGGAGTTGGCAAGGCCAAGGAAGTCATTGCCGCGGTTCAGAAGTCCGCCGTCAATGCCAGGAGGAACATCATCAAGGTTCCTATGACTAAGTACTCCACTTTTCCCCATAGAGCTGACGGAGATTATGGAGCGGCAAAGGTGATGCTTAGACCTGCATCTCCGGGTACTGGAGTTATTGCTGGTGGGTCAGTGAGAATTGTTCTTGAAATGGCTGGAGTTGAGAATGCTTTGGGAAAACAACTAGGGAGTAATAATGCACTCAACAATGCCAGAGCAACCGTTGTTGCTGTGCAGAAAATGAAGCAGTTTCGTGAGGTTGCTGAGGAGCGTGGGATTCCAATGGAAGAATTGTGGAAGTAA

>Glyma07g31830.1   sequence type=predicted peptide   gene model=Glyma07g31830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAAPSLSSALNSLSSLSLSTSSRFSLLPPPSLLSKPLPLLFATTTLKSKPSDDIDTSFFDNINPQDDITFNPPEPPEGFVAPPSFDDGPLETEDEIAAAYEELYGPGYSGVSVLGNDVYVMDAKVKKETGFGSGAKKEKVRDGFEERVVQVRRVTKVVKGGKQLRFRAVVVVGDKKGSVGVGVGKAKEVIAAVQKSAVNARRNIIKVPMTKYSTFPHRADGDYGAAKVMLRPASPGTGVIAGGSVRIVLEMAGVENALGKQLGSNNALNNARATVVAVQKMKQFREVAEERGIPMEELWK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo