Report for Sequence Feature Glyma07g31030
Feature Type: gene_model
Chromosome: Gm07
Start: 35979999
stop: 35982021
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma07g31030
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G05000 AT
Annotation by Michelle Graham. TAIR10: Vacuolar protein sorting-associated protein VPS28 family protein | chr4:2563953-2564585 FORWARD LENGTH=210
SoyBase E_val: 5.00E-137 ISS
GO:0006810 GO-bp
Annotation by Michelle Graham. GO Biological Process: transport
SoyBase N/A ISS
GO:0000813 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: ESCRT I complex
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005215 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transporter activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
KOG3284
KOG
Vacuolar sorting protein VPS28
JGI ISS
PTHR12937 Panther
VACUOLAR PROTEIN SORTING 28, ISOFORM 2 (VPS28)
JGI ISS
PF03997 PFAM
VPS28 protein
JGI ISS
UniRef100_G7JRS3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar protein sorting-associated protein-like protein n=1 Tax=Medicago truncatula RepID=G7JRS3_MEDTR
SoyBase E_val: 1.00E-144 ISS
UniRef100_I1KLE1 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KLE1_SOYBN
SoyBase E_val: 4.00E-156 ISS
Expression Patterns of Glyma07g31030
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma07g31030
Paralog Evidence Comments
Glyma08g06280 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma07g31030 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.07g191000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma07g31030
Coding sequences of Glyma07g31030
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma07g31030.1 sequence type=CDS gene model=Glyma07g31030 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACTACCATGGAGGTTAAGCTATGGAATGACAAGCGCGAGAGAGAAATGTATGACAACTTTGGGGAGCTTTATGCCATTATCAAAGCCACTGAGAGGCTTGAGAAGGCCTATGTTAGAGATATAATCTCACCCCAGGAATATGAGTTAGAGTGCCAGAAGCTCATAGCTCATTTCAAAACCTTAGCTTCCACCCTTAAAGACACCGTGCCTAGCATTGAGCGATTTGCAGATACTTACAAGATGGAGTGCCCAGCGGCGATTAACCGTCTTGTGGTTTCCGGTGTTCCTGCTACGGTGGAGCATCGTGCGACTGTGGCTGCCTCTGCTTCCACCTCGGCTGCTATTGTGGCCGAGTGCGTGCAGAATTTTATTACTTCTATGGATTCTTTGAAACTTAACATGGTGGCTGTGGATCAGGTGCACCCGTTGCTCTCGGACCTTTATGCTTCACTCAATAAGTTGACTATCCTGCCACCTGATTTTGAGGGGAAAACAAAAATGAAGGAGTGGATTGCGAGGTTATCCAAGATGGGTGCAGCTGATGAGTTGACTGAACAACAGGCGCGGCAGCTTCACTTTGATCTTGAGTCTTCTTACAATTCCTTTATGGCAGCCCTGCCCAATGCTGGTACATGA
Predicted protein sequences of Glyma07g31030
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma07g31030.1 sequence type=predicted peptide gene model=Glyma07g31030 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTTMEVKLWNDKREREMYDNFGELYAIIKATERLEKAYVRDIISPQEYELECQKLIAHFKTLASTLKDTVPSIERFADTYKMECPAAINRLVVSGVPATVEHRATVAASASTSAAIVAECVQNFITSMDSLKLNMVAVDQVHPLLSDLYASLNKLTILPPDFEGKTKMKEWIARLSKMGAADELTEQQARQLHFDLESSYNSFMAALPNAGT*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
