Glyma07g28981 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g28981

Feature Type:	gene_model
Chromosome:	Gm07
Start:	33366040
stop:	33367122
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g28981

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G08410	AT	Annotation by Michelle Graham. TAIR10: P-loop containing nucleoside triphosphate hydrolases superfamily protein \| chr1:2646307-2649106 FORWARD LENGTH=589	SoyBase	E_val: 4.00E-54	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
PTHR11089	Panther	GTP-BINDING PROTEIN-RELATED	JGI		ISS
PTHR11089:SF7	Panther	PUTATIVE NUCLEOTIDE BINDING PROTEIN	JGI		ISS
UniRef100_G7JES9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Large subunit GTPase-like protein n=1 Tax=Medicago truncatula RepID=G7JES9_MEDTR	SoyBase	E_val: 1.00E-54	ISS
UniRef100_I1LRL9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LRL9_SOYBN	SoyBase	E_val: 4.00E-100	ISS

Expression Patterns of Glyma07g28981

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g28981 not represented in the dataset	Glyma07g28981 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g28981 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g176900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g28981

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g28981

Limit To All Plant Sequences

>Glyma07g28981.1   sequence type=CDS   gene model=Glyma07g28981   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGAAGAAGCAGAACGAGATCCAGAAAATAGGGCTAGGCCGAGCCCAGGTGAAGCAGCACAACCAGATGATCCAACAGGGCAAGGACAAGTCTCGCTTCTACAGGAAGAAGTTCCTTGAATCCTTCACCGAAGTCTTCGACATCAACGTTGTCGTCAAGCAATCCCTAGAACCCCTCCCCGAACTCGCCCCTGCCATTTCAACCACTCTCATCAGCCTTGAACCAAGTTCCGTGCCCGATGAAACGACGACATCGGAAGAAGTGAGGAAGCAGCAAAAGCAAGAGGAGGCGCTCCACACCAGCAGCCTCCGCGTTCCTTGCCGCCCGCCGTGGACTCCCGACATGTCCGCGGATGAGCTGAACACCAGCAAAACGCAAGCTTTCTTGACCTGGCGCCGCAGCTTGGTGAGGCTTGAGGAGAATAAGAAGCTTGTTCTTACTCCGTTTGAGAAGAATCTTGACATCTGGAGACAGCTCTGGCGGGTTGTTGAGCGCAGTGATCTGTTATGTTGGTATCATCTTTGA

Predicted protein sequences of Glyma07g28981

Limit To All Plant Sequences

>Glyma07g28981.1   sequence type=predicted peptide   gene model=Glyma07g28981   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKKQNEIQKIGLGRAQVKQHNQMIQQGKDKSRFYRKKFLESFTEVFDINVVVKQSLEPLPELAPAISTTLISLEPSSVPDETTTSEEVRKQQKQEEALHTSSLRVPCRPPWTPDMSADELNTSKTQAFLTWRRSLVRLEENKKLVLTPFEKNLDIWRQLWRVVERSDLLCWYHL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain