Glyma07g28940 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g28940

Feature Type:	gene_model
Chromosome:	Gm07
Start:	33238790
stop:	33241844
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g28940

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G25610	AT	Annotation by Michelle Graham. TAIR10: BURP domain-containing protein \| chr5:8914498-8916684 REVERSE LENGTH=392	SoyBase	E_val: 8.00E-54	ISS
GO:0009269	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to desiccation	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005768	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endosome	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005802	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network	SoyBase	N/A	ISS
GO:0045735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity	SoyBase	N/A	ISS
PF03181	PFAM	BURP domain	JGI		ISS
UniRef100_Q8RUD9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Seed coat BURP domain protein 1 n=1 Tax=Glycine max RepID=Q8RUD9_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q8RUD9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Seed coat BURP domain protein 1 n=1 Tax=Glycine max RepID=Q8RUD9_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma07g28940

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g28940 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g176700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g28940

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g28940

Limit To All Plant Sequences

>Glyma07g28940.1   sequence type=CDS   gene model=Glyma07g28940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGTTTCATTGCCTTCCAATATTTCTTTATCTCAATTTGATGTTGATGACAGCCAATGCTGCGTTAACTCCTAGACATTACTGGGAAACGATGCTTCCAAGAACTCCCTTGCCGAAAGCAATCACAGAGCTACTAAGCCTTGAAAGTAGGTCCATATTTGAATATGCCGGGAATGATGACCAGTCAGAAAGTAGGTCCATATTAGGATACGCTGGCTATAATCAAGACGAGGATGATGTGAGCAAACACAATATACAAATCTTCAACAGGTTGTTTTTCTTGGAAGAGGACCTGCGTGCTGGCAAAATATTCAACATGAAGTTCGTCAACAACACAAAAGCCACAGTCCCGTTGCTACCGCGCCAAATTTCGAAACAAATACCGTTCTCAGAAGATAAAAAGAAGCAAGTGTTGGCGATGCTTGGCGTGGAAGCGAACTCAAGCAACGCCAAGATCATAGCGGAGACCATTGGTCTTTGCCAAGAGCCTGCAACGGAGGGAGAAAGGAAACACTGCGCGACTTCGTTGGAGTCCATGGTTGATTTCGTCGTTTCCGCGCTCGGGAAGAACGTTGGTGCTTTCTCAACAGAGAAAGAAAGGGAAACTGAGTCTGGAAAGTTTGTAGTGGTGAAAAATGGGGTGAGGAAGTTGGGAGATGATAAGGTTATTGCCTGTCATCCAATGAGTTACCCTTATGTTGTGTTTGGGTGTCATCTAGTGCCAAGGAGTAGCGGGTATTTGGTGCGCTTGAAGGGAGAAGATGGGGTTCGAGTGAAAGCAGTTGTTGCGTGCCACAGAGACACGTCAAAGTGGGACCATAATCATGGGGCATTCAAAGTGCTCAATCTTAAGCCTGGGAATGGTACAGTATGCCATGTCTTCACTGAGGGGAATCTTCTTTGGCTTCCAAATTAG

Predicted protein sequences of Glyma07g28940

Limit To All Plant Sequences

>Glyma07g28940.1   sequence type=predicted peptide   gene model=Glyma07g28940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEFHCLPIFLYLNLMLMTANAALTPRHYWETMLPRTPLPKAITELLSLESRSIFEYAGNDDQSESRSILGYAGYNQDEDDVSKHNIQIFNRLFFLEEDLRAGKIFNMKFVNNTKATVPLLPRQISKQIPFSEDKKKQVLAMLGVEANSSNAKIIAETIGLCQEPATEGERKHCATSLESMVDFVVSALGKNVGAFSTEKERETESGKFVVVKNGVRKLGDDKVIACHPMSYPYVVFGCHLVPRSSGYLVRLKGEDGVRVKAVVACHRDTSKWDHNHGAFKVLNLKPGNGTVCHVFTEGNLLWLPN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain