SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g28850

Feature Type:gene_model
Chromosome:Gm07
Start:32970925
stop:32978569
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g28850
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G17700AT Annotation by Michelle Graham. TAIR10: cyclic nucleotide-binding transporter 1 | chr3:6049074-6052449 FORWARD LENGTH=764 SoyBaseE_val: 8.00E-46ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006811GO-bp Annotation by Michelle Graham. GO Biological Process: ion transport SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009624GO-bp Annotation by Michelle Graham. GO Biological Process: response to nematode SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005216GO-mf Annotation by Michelle Graham. GO Molecular Function: ion channel activity SoyBaseN/AISS
GO:0005516GO-mf Annotation by Michelle Graham. GO Molecular Function: calmodulin binding SoyBaseN/AISS
GO:0030551GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclic nucleotide binding SoyBaseN/AISS
PTHR10217Panther VOLTAGE AND LIGAND GATED POTASSIUM CHANNEL JGI ISS
PTHR10217:SF7Panther POTASSIUM CHANNEL PROTEIN EAG-RELATED JGI ISS
UniRef100_G7K6G2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cyclic nucleotide gated channel n=1 Tax=Medicago truncatula RepID=G7K6G2_MEDTR SoyBaseE_val: 5.00E-63ISS
UniRef100_I1KGV2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KGV2_SOYBN SoyBaseE_val: 2.00E-139ISS

Expression Patterns of Glyma07g28850
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g28850 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma07g28850
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g28850
>Glyma07g28850.1   sequence type=CDS   gene model=Glyma07g28850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCATTTTGAAAAAGATGAGGTACCAATGATGTCAGAAACACATGCTCAACTATCTGATGAAGTTGTGGATTCTAATTTCCGAAGGCTTGTATCTAGGACACGAAGTGCTTCAATTTCTATTCCTATGGCCTCCTTGGAATCATATGAGAAAGAAACTAGTCTTGTGGGACATACTGGTCCACTTCATAGTGTGAGAAAAACCCCCTCTGTGCAGATCAGTGGTCCACTGTATGCTACCAATGGAACTGGAAATCTTTCACGACAGAATATAGTTGCAACACGAACCAAAGTAATGGAGAGCAAGACAGAAAAGTTTTCTACTTTCAATGGCACAGATGAAAATCGTATGGGCAACTTGGAGTGTGTAATGATCCTTATTGTACTACTTGCCCCACTTATTTCAAGGCTTCTCAGCCAAGAACCCGAAGAACTTCAGCTATATTTGATCCCAAGGAAACTGATTTCTAGGAGAAGCTTTTGCTTGCTTGTGCCTATACATTATGTTCATTTACTAATTACTATTCTTAATCTTGAATTCTTAATTGGTTATGTTTCTCCTGAGTCAAGGGTAGTAGGTGCTGGAGATTTAGTTGATCATCCCAAGAAAATTGCTCTTAATTATCTGAAGGGTTATTTTTTCATTGACCTATTTGTTGTATTGCCTCTACCTCAGATAATGATATCATTTGTCCTACGAAAGTACTTGGGAATATCCGGAGAAAATTTTGCTAAAAATCTTCTGCGTGCAGCAATCCTTTTGCAGTATTTTCCCAGATTATTCAGGTTTCTGCCTCTGCTAATTGGCCAAAAAATAAACTATGATAGTAGTAGGGTTAATCAATGCTTGCGAAAGGCCTGCCAACATTCTAATATTACTGGATGCTCAGCATTTATTGATTGTGGCAGTGACCGTGCATCTGACCAGTCAAAACTGTGGAACAAAAATGTAAATGCCACTGCTTGTTTGGATTCCAGTTCCGGTGCTTTTCCATATGGGATCTATGTACATGTTGTACCACTTACTATAGAAACTAGGGTGGTCAAAAAATAT
Predicted protein sequences of Glyma07g28850
>Glyma07g28850.1   sequence type=predicted peptide   gene model=Glyma07g28850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAHFEKDEVPMMSETHAQLSDEVVDSNFRRLVSRTRSASISIPMASLESYEKETSLVGHTGPLHSVRKTPSVQISGPLYATNGTGNLSRQNIVATRTKVMESKTEKFSTFNGTDENRMGNLECVMILIVLLAPLISRLLSQEPEELQLYLIPRKLISRRSFCLLVPIHYVHLLITILNLEFLIGYVSPESRVVGAGDLVDHPKKIALNYLKGYFFIDLFVVLPLPQIMISFVLRKYLGISGENFAKNLLRAAILLQYFPRLFRFLPLLIGQKINYDSSRVNQCLRKACQHSNITGCSAFIDCGSDRASDQSKLWNKNVNATACLDSSSGAFPYGIYVHVVPLTIETRVVKKY






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo