Glyma07g27290 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g27290

Feature Type:	gene_model
Chromosome:	Gm07
Start:	30275774
stop:	30282967
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g27290

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G14750	AT	Annotation by Michelle Graham. TAIR10: Cyclin family protein \| chr1:5079674-5082423 REVERSE LENGTH=410	SoyBase	E_val: 5.00E-46	ISS
GO:0000079	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of cyclin-dependent protein kinase activity	SoyBase	N/A	ISS
GO:0000724	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination	SoyBase	N/A	ISS
GO:0010440	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal lineage progression	SoyBase	N/A	ISS
GO:0051026	GO-bp	Annotation by Michelle Graham. GO Biological Process: chiasma assembly	SoyBase	N/A	ISS
GO:0051726	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0004693	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase activity	SoyBase	N/A	ISS
GO:0019901	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein kinase binding	SoyBase	N/A	ISS
PTHR10177	Panther	CYCLINS	JGI		ISS
PTHR10177:SF17	Panther	G2/MITOTIC-SPECIFIC CYCLIN B	JGI		ISS
PF02984	PFAM	Cyclin, C-terminal domain	JGI		ISS
UniRef100_B9SNG1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cyclin, putative n=1 Tax=Ricinus communis RepID=B9SNG1_RICCO	SoyBase	E_val: 3.00E-58	ISS
UniRef100_I1KKX1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KKX1_SOYBN	SoyBase	E_val: 1.00E-162	ISS

Expression Patterns of Glyma07g27290

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g27290 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma07g27290

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g27290

Limit To All Plant Sequences

>Glyma07g27290.1   sequence type=CDS   gene model=Glyma07g27290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTGAGGAAGAGGGAGAGGAAGCAGGGTTTTGTGTCGAATTATGGTGATAGATATTTCTCTACCACTGAATTCGGAGACATCGTGATTGAGCAACGTGCGCTAATGGTTCAGTGGATCGTTGAGGTAGAGAGAAAACACCCCATTGCACGAGAAATTCTGATTGCGCTCCTCTTCCATGATACGACAACCCGCTGGTTGGTTCTGATCGTGTGCAGCGAAAGGATCTTCGAACCTTCTGAACACCAATGCTCTTGCTCTCACAAAATAAGTTTTTTTTATAGAGTGGGGCAAAAAAATTTCTACATAGGAAGCAATGTGTACGGTAGATGCGAGGTGGTAGCTACGGAATGGGTGGTGCAGGAGGTGCTCAAGTTTCAGTGCTTTCAACCTACCATCTACAATTTCTTGCAGTATTACCTAAAAGCAGCTAATGCTGATGCAGAGGTTCAGAAGAGGGTCAAGTATCTGGCAGAGCTGGCACTGTCAGGTCATGAGCAACTGTGCTACCGGCCTTCAACAGTTGCTGCAGCACTTGTAATCCTGGCTTGTCTTGAAGTCAATCAAATTTCATACCACAAAGTCATAGGGATTCACGTTAGATCAAAAGATGAGAATTTGTACGAATGCATAGAGAATCTGGAGTGGGTGTTACGCTATCTAGGATAG

Predicted protein sequences of Glyma07g27290

Limit To All Plant Sequences

>Glyma07g27290.1   sequence type=predicted peptide   gene model=Glyma07g27290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLRKRERKQGFVSNYGDRYFSTTEFGDIVIEQRALMVQWIVEVERKHPIAREILIALLFHDTTTRWLVLIVCSERIFEPSEHQCSCSHKISFFYRVGQKNFYIGSNVYGRCEVVATEWVVQEVLKFQCFQPTIYNFLQYYLKAANADAEVQKRVKYLAELALSGHEQLCYRPSTVAAALVILACLEVNQISYHKVIGIHVRSKDENLYECIENLEWVLRYLG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain