SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g27238): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g27238): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g27238

Feature Type:gene_model
Chromosome:Gm07
Start:30182102
stop:30184388
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g27238
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G14760AT Annotation by Michelle Graham. TAIR10: KNOX Arabidopsis thaliana meinox | chr1:5084530-5085213 REVERSE LENGTH=138 SoyBaseE_val: 8.00E-23ISS
GO:0001708GO-bp Annotation by Michelle Graham. GO Biological Process: cell fate specification SoyBaseN/AISS
GO:0010589GO-bp Annotation by Michelle Graham. GO Biological Process: leaf proximal/distal pattern formation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
PF03790PFAM KNOX1 domain JGI ISS
PF03791PFAM KNOX2 domain JGI ISS
UniRef100_G7KQB4UniRef Annotation by Michelle Graham. Best UniRef hit: Fused compound leaf 1 n=1 Tax=Medicago truncatula RepID=G7KQB4_MEDTR SoyBaseE_val: 4.00E-22ISS
UniRef100_G7KQB4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fused compound leaf 1 n=1 Tax=Medicago truncatula RepID=G7KQB4_MEDTR SoyBaseE_val: 4.00E-22ISS

Expression Patterns of Glyma07g27238
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g27238 not represented in the dataset
Glyma07g27238 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g27238 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g172500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g27238
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g27238
>Glyma07g27238.1   sequence type=CDS   gene model=Glyma07g27238   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGCTAGACAAATTGGAGAAAATGGATCAGGGAGAAAGGGGGTCGAGGAAAGTGATGTAGAGATCAAAGAAAATGAAGAGGTTTTAAAGAAGATTATTGCAAGTCATCCTTTGTATGAAGTTTTGATTCAATCCCACATCAACTGCTTGAAGGTGGGATTAAGCGAAGCTGGAGAGTTTGATGCAACAAGTGAGGCATGGAACAAGCTGGTTAACTCGAAGTCCAAAGCAACTCCAAGTCCAAACACTTCAGAGTTAGATCACTTCATGGAAGCGTATTGCATGGCACTGAGCAAGCTGAGGGAAGCGATAGAGGAACCAACAAAAGAAACCAATGCTTTCATCAGAGCTACGTATCTTCAACTAAAGGAACTCAATGAACTGAATTGA
Predicted protein sequences of Glyma07g27238
>Glyma07g27238.1   sequence type=predicted peptide   gene model=Glyma07g27238   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEARQIGENGSGRKGVEESDVEIKENEEVLKKIIASHPLYEVLIQSHINCLKVGLSEAGEFDATSEAWNKLVNSKSKATPSPNTSELDHFMEAYCMALSKLREAIEEPTKETNAFIRATYLQLKELNELN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo