Glyma07g22950 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g22950): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g22950): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g22950

Feature Type:	gene_model
Chromosome:	Gm07
Start:	24679284
stop:	24683069
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g22950

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G43630	AT	Annotation by Michelle Graham. TAIR10: FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, nucleus, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT3G59640.2); Has 67 Blast hits to 67 proteins in 20 species: Archae - 0; Bacteria - 4; Metazoa - 9; Fungi - 1; Plants - 49; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink). \| chr2	SoyBase	E_val: 2.00E-57	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009644	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to high light intensity	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_G7LDX3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Salicylic acid carboxyl methyltransferase n=1 Tax=Medicago truncatula RepID=G7LDX3_MEDTR	SoyBase	E_val: 1.00E-38	ISS
UniRef100_I1KKR6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KKR6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma07g22950

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g22950 not represented in the dataset	Glyma07g22950 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g22950 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g165200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g22950

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g22950

Limit To All Plant Sequences

>Glyma07g22950.1   sequence type=CDS   gene model=Glyma07g22950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATATTGCACAAGTTACAGCATGGCAGCCTGGGATTTGTGTGAAAAATATGTCTCAGTTGCACCGGCTTCAATCTAAACCATGTGTTATACCAAAGAGTTTTGGTCCTCTCACTTGTGTTCTACTGAGCTTAAGAGCAAGACAATCGTTTAGCTCGAAATGTTGGCCCATTTTACAATCTCGGAAACCTCTTCATATTTGCTTAGCCGGTGGAAAAGGGATGATGGGAAATGATGAGAATTCCCCATGGAAATCTATTGAGAAAGCTATTGGAAAATTTAAGGGAGAATCATCAATAGAGGATGTATTACGGCGCCAAATTGAAAAGGGTGTATATTATGACAGTGGTGGTGGTGGAGTGAAACCACCAGGAGGCGGGAACAGTGGTGGTGGCCCTGATGGCTCTGGTGAATCAGAAGAAGAAAGCCTTGCTGGGATGTGGGAAGAAAATATCCAAGTGATTTTAGCGACCCTTGGCTTTATATTTCTGTACATTTATATTCTCACTGGGGAGGAACTCACAAAGCTAGCTAGAGACTATATCAAGTATCTATTTGGGGGAAGCCAGAGTGTCCGACTGAAAAATGCCATGTATCAATGGGGACAACTCTATGAAAGCATGACAGCTCAGAAAGAAGAGGAAGACGAGTATTGGTTGCAGAAGGCCATTCTGGATACACCAACTTGGTGGCACGACCCTGCTGATTACCGTGAAGCCCTTAAAAACTACTTGCTATCAGGTACAGATGAGGCCATTGCCACCAGGAATTACTTAGAATTAGATTCAGATGCAGACGTTAGGTATTGCTTGGAATCAGATGACGAAGAAGATGAAGATGAAGATCAATATCAATATAAAGATGATTATGAAGAAAAGTTTGCCTAG

Predicted protein sequences of Glyma07g22950

Limit To All Plant Sequences

>Glyma07g22950.1   sequence type=predicted peptide   gene model=Glyma07g22950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNIAQVTAWQPGICVKNMSQLHRLQSKPCVIPKSFGPLTCVLLSLRARQSFSSKCWPILQSRKPLHICLAGGKGMMGNDENSPWKSIEKAIGKFKGESSIEDVLRRQIEKGVYYDSGGGGVKPPGGGNSGGGPDGSGESEEESLAGMWEENIQVILATLGFIFLYIYILTGEELTKLARDYIKYLFGGSQSVRLKNAMYQWGQLYESMTAQKEEEDEYWLQKAILDTPTWWHDPADYREALKNYLLSGTDEAIATRNYLELDSDADVRYCLESDDEEDEDEDQYQYKDDYEEKFA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain