|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT2G05920 | AT | Annotation by Michelle Graham. TAIR10: Subtilase family protein | chr2:2269831-2272207 REVERSE LENGTH=754 | SoyBase | E_val: 5.00E-21 | ISS |
| GO:0000394 | GO-bp | Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation | SoyBase | N/A | ISS |
| GO:0006508 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proteolysis | SoyBase | N/A | ISS |
| GO:0008152 | GO-bp | Annotation by Michelle Graham. GO Biological Process: metabolic process | SoyBase | N/A | ISS |
| GO:0009086 | GO-bp | Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process | SoyBase | N/A | ISS |
| GO:0009664 | GO-bp | Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization | SoyBase | N/A | ISS |
| GO:0009832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis | SoyBase | N/A | ISS |
| GO:0010075 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth | SoyBase | N/A | ISS |
| GO:0043086 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of catalytic activity | SoyBase | N/A | ISS |
| GO:0048653 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anther development | SoyBase | N/A | ISS |
| GO:0005576 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: extracellular region | SoyBase | N/A | ISS |
| GO:0005618 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell wall | SoyBase | N/A | ISS |
| GO:0005794 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus | SoyBase | N/A | ISS |
| GO:0009505 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall | SoyBase | N/A | ISS |
| GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
| GO:0004252 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: serine-type endopeptidase activity | SoyBase | N/A | ISS |
| GO:0042802 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: identical protein binding | SoyBase | N/A | ISS |
| PTHR10795 | Panther | SUBTILISIN/KEXIN-RELATED SERINE PROTEASE | JGI | ISS | |
| PTHR10795:SF17 | Panther | gb def: possible protease [sinorhizobium meliloti] | JGI | ISS | |
| PF00082 | PFAM | Subtilase family | JGI | ISS | |
| UniRef100_I1N3W4 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1N3W4_SOYBN | SoyBase | E_val: 2.00E-60 | ISS |
| UniRef100_Q2HV71 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Protease-associated PA; Proteinase inhibitor I9, subtilisin propeptide n=1 Tax=Medicago truncatula RepID=Q2HV71_MEDTR | SoyBase | E_val: 6.00E-48 | ISS |
|
Glyma07g19335 not represented in the dataset |
Glyma07g19335 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.07g157000 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma07g19335.1 sequence type=CDS gene model=Glyma07g19335 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCACCTAGCTCTAATGTTCTTGCTGCTTATGTTCCTACAGAAGTAGTAGCAACAATTGGCAACAATGTGATGTTATCTAGTGGCTACAATTTGCTGTCTGGAACATCCATGGCATGCCCTCATGCTTCTGGTGTTGCTGCTCTTTTGAAAGCTGCACACACTAAATGGAGTGCTGCTGCTATAAGGTCTGCACTAGTAACCACAGCTAGTCCTCTTGATAATACACAAAATCCAATTAGGGACTATGGTTACCCTTCTCAATATGCTTCCCCTCTTGCCATTGGAGCTGGTCAAATTGACCCCAACAAAGCATTTTTTGTTATATTATTATGCTTTCAATTCTCTAATACCTGA
>Glyma07g19335.1 sequence type=predicted peptide gene model=Glyma07g19335 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MAPSSNVLAAYVPTEVVATIGNNVMLSSGYNLLSGTSMACPHASGVAALLKAAHTKWSAAAIRSALVTTASPLDNTQNPIRDYGYPSQYASPLAIGAGQIDPNKAFFVILLCFQFSNT*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||