SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g19120

Feature Type:gene_model
Chromosome:Gm07
Start:19025086
stop:19025622
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g19120
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G38310AT Annotation by Michelle Graham. TAIR10: PYR1-like 4 | chr2:16050251-16050874 FORWARD LENGTH=207 SoyBaseE_val: 2.00E-78ISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF10604PFAM Polyketide cyclase / dehydrase and lipid transport JGI ISS
UniRef100_G7KT83UniRef Annotation by Michelle Graham. Most informative UniRef hit: Abscisic acid receptor PYL4 n=1 Tax=Medicago truncatula RepID=G7KT83_MEDTR SoyBaseE_val: 2.00E-91ISS
UniRef100_I1KKJ7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KKJ7_SOYBN SoyBaseE_val: 2.00E-126ISS

Expression Patterns of Glyma07g19120
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g19120
ParalogEvidenceComments
Glyma18g43676 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g19120 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g155500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g19120
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g19120
>Glyma07g19120.1   sequence type=CDS   gene model=Glyma07g19120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCACCTAACAATCCTTCCACGATTGTTTCCGACGCGGTGGCTCGGCACCACACCCATGTCGTGTCCCCGCACCAGTGCTGCTCCGCCGTGGTGCAGGAGATTGCCGCCCCGGTCTCCACCGTGTGGTCCGTCGTGCGGCGCTTCGACAACCCGCAGGCCTACAAGCACTTCGTCAAGAGCTGCCACGTCATCCTCGGCGACGGCGATGTCGGGACCCTCCGCGAGGTCCGCGTGATCTCCGGTCTCCCTGCCGCCGTCAGCACCGAGCGCCTCGACGTCCTCGACGACGAGCGCCACGTCATCGGCTTCAGCATGGTCGGTGGCGACCACCGCCTCTCCAACTACCGCTCCGTCACCATCCTCCACCCCCGTTCCGCCACCGACACCGTCGTCGTCGAGTCCTACGTCGTCGACGTCCCTGCCGGCAACACCACCGAGGACACTCGCGTCTTCGTCGACACCATCCTCCGCTGCAACCTCCAATCCCTCGCCAAATTCGCCGAAAACCTAACCAACAAACTCCATCAACGATGA
Predicted protein sequences of Glyma07g19120
>Glyma07g19120.1   sequence type=predicted peptide   gene model=Glyma07g19120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSPNNPSTIVSDAVARHHTHVVSPHQCCSAVVQEIAAPVSTVWSVVRRFDNPQAYKHFVKSCHVILGDGDVGTLREVRVISGLPAAVSTERLDVLDDERHVIGFSMVGGDHRLSNYRSVTILHPRSATDTVVVESYVVDVPAGNTTEDTRVFVDTILRCNLQSLAKFAENLTNKLHQR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo