Glyma07g18912 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g18912): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g18912): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g18912

Feature Type:	gene_model
Chromosome:	Gm07
Start:	18882578
stop:	18885175
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g18912

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G05420	AT	Annotation by Michelle Graham. TAIR10: acyl-CoA binding protein 4 \| chr3:1561880-1567047 FORWARD LENGTH=668	SoyBase	E_val: 5.00E-53	ISS
GO:0006869	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipid transport	SoyBase	N/A	ISS
GO:0009416	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to light stimulus	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0000062	GO-mf	Annotation by Michelle Graham. GO Molecular Function: fatty-acyl-CoA binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PTHR23244	Panther	KELCH REPEAT DOMAIN	JGI		ISS
PTHR23244:SF29	Panther	RANGAP1-INTERACTING PROTEIN-RELATED	JGI		ISS
UniRef100_A2Q340	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Acyl-CoA-binding domain-containing protein n=1 Tax=Medicago truncatula RepID=A2Q340_MEDTR	SoyBase	E_val: 4.00E-53	ISS
UniRef100_UPI000233906E	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233906E related cluster n=1 Tax=unknown RepID=UPI000233906E	SoyBase	E_val: 1.00E-121	ISS

Expression Patterns of Glyma07g18912

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g18912 not represented in the dataset	Glyma07g18912 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g18912 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g154200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g18912

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g18912

Limit To All Plant Sequences

>Glyma07g18912.1   sequence type=CDS   gene model=Glyma07g18912   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACACCAAGGAGGTTTGAAATGACGATGACGATAAGGACCGCGAGAACAACAACGTCATTTCATTCGCGAAGATCCTCACTCCCTCCGACGCCAACAATGGCGACGACTTCTCTGTGCCACGCTTCTGCGCCGACTCGTGCTTCCCTCCACTCGACTTTCGCACCGATCTGCCTGTCTAGCTCCTCTCTGTCGCTGACATCCACGGCGTCGAGTGGCGCTTCCGCCACATCTACCATGGCACGCCACGCCACCACTTCTTCACCATCGGCTGGAGCAAGTTTGTCAATCATAAGAAGCTCGTCGCCGGCGACACTGTCATTTTCGTCAAGGACTCCCACGATGGAATGGTCTCGCCCAACGCAGCTAGGAGAAATACCATCACCACGTGCTGGACATGCTGGTGTGACAGTAGGGGAAAACTGGTTCATTGTTAGTGGTGGTGACAATAAGAGTGGGGTCTCTGAAACGATTGTACTGAATATGTCTACACTGACTTGGTCAGTGGTAACTTCTGTTCAAGGACGAGTTCCTGTTGCCAGTGAGGGATTGAGCTTGGTTGTAAGCTCTTATGATGGTGAAGATATACTTGTATCTTTTGGAGGGTACAATGGACGTTACAACAATGAAAATATTATTTCAAAATTTTGCCTTGCTTCTGCTTTCTTTTGCTTTTGTTTTATCTTTCGCCTTCGTTTGATTTGGTTTGCTGCCTTTAGGTCTATGTTCTTAAACCAAGCCACAAATCAACCTTGCAATCCAAAATAA

Predicted protein sequences of Glyma07g18912

Limit To All Plant Sequences

>Glyma07g18912.1   sequence type=predicted peptide   gene model=Glyma07g18912   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTPRRFEMTMTIRTARTTTSFHSRRSSLPPTPTMATTSLCHASAPTRASLHSTFAPICLSSSSLSLTSTASSGASATSTMARHATTSSPSAGASLSIIRSSSPATLSFSSRTPTMEWSRPTQLGEIPSPRAGHAGVTVGENWFIVSGGDNKSGVSETIVLNMSTLTWSVVTSVQGRVPVASEGLSLVVSSYDGEDILVSFGGYNGRYNNENIISKFCLASAFFCFCFIFRLRLIWFAAFRSMFLNQATNQPCNPK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain