SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g18370

Feature Type:gene_model
Chromosome:Gm07
Start:18300058
stop:18304347
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g18370
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G51840AT Annotation by Michelle Graham. TAIR10: acyl-CoA oxidase 4 | chr3:19225653-19229008 REVERSE LENGTH=436 SoyBaseE_val: 0ISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0016558GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix SoyBaseN/AISS
GO:0044265GO-bp Annotation by Michelle Graham. GO Biological Process: cellular macromolecule catabolic process SoyBaseN/AISS
GO:0046459GO-bp Annotation by Michelle Graham. GO Biological Process: short-chain fatty acid metabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0003995GO-mf Annotation by Michelle Graham. GO Molecular Function: acyl-CoA dehydrogenase activity SoyBaseN/AISS
GO:0003997GO-mf Annotation by Michelle Graham. GO Molecular Function: acyl-CoA oxidase activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016627GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-CH group of donors SoyBaseN/AISS
GO:0050660GO-mf Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding SoyBaseN/AISS
KOG0138 KOG Glutaryl-CoA dehydrogenase JGI ISS
PTHR10909Panther ELECTRON TRANSPORT OXIDOREDUCTASE JGI ISS
PTHR10909:SF129Panther SUBFAMILY NOT NAMED JGI ISS
PF00441PFAM Acyl-CoA dehydrogenase, C-terminal domain JGI ISS
PF02770PFAM Acyl-CoA dehydrogenase, middle domain JGI ISS
PF02771PFAM Acyl-CoA dehydrogenase, N-terminal domain JGI ISS
UniRef100_B9T1J4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Acyl-CoA dehydrogenase, putative n=1 Tax=Ricinus communis RepID=B9T1J4_RICCO SoyBaseE_val: 0ISS
UniRef100_UPI0002339069UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339069 related cluster n=1 Tax=unknown RepID=UPI0002339069 SoyBaseE_val: 0ISS

Expression Patterns of Glyma07g18370
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g18370
ParalogEvidenceComments
Glyma18g43240 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g18370 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g151500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g18370
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g18370
>Glyma07g18370.2   sequence type=CDS   gene model=Glyma07g18370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGATGCCTTCGTATTTTAATTTGCCAGCACTTGATGTTTCTGTGGCTTTTCCACAAGCCACTCCAGCCTCTAATTTTCCTCCTTGTGCTTCGGATTATTTTCATTTCAATGACTTGTTGAAACCGGAGGAGCAGGCCGTGAGGAACAAAGTGAGAGAGTGTATGGAAAAAGAAATTGCTCCTATAATGACTGAGTACTGGGAGAAGGCTGAATTCCCATTTCATGTTATCCCAAAGTTTGCTGCCCTGCGTATTGCTGGTGGCACAATTAAGGGTTATGGTTGTCCTGGTCTTTCCATAACTGGAAGTGCTGTTGCTACAGCAGAAGTTGCTAGAGTTGATGCAAGCTGTTCAACTTTCTATTTGGTTCATTCTTCCTTGGCAATGCTCACTATTGCATTATGTGGGTCTGAAGCTCAGAAGCAAAAGTATTTGCCTTCTTTGGCTCAAATGAAAACTATAGCATGTTGGGTGGGAGGTGGTTGGATCCTTGATGGCCAAAAGAGATGGATAGGAAACAGTACGTTTGCTGATTTGTTGGTTATCTTTGCTAGGAATACGACAACGAATCAAATAAATGGATATATTGTCAAAAAGGATGCACCAGGATTAACAGTAACAAAAATGGAGAATAAAATTGGACTTAGGATCGTACAAAACGGAGACATAGTTATGAGGAAAGTTTTTGTCCCTGATGATGACAGAATAGAAGGAGTAAATTCTTTTCAGGATACAAACAAGGTACTTGCTGTTTCACGTGTAATGGTTGCTTGGCAACCTATTGGTTTATCAATGGGCATCTATGATATGTGTCATAGGTACCTAAAGGAGAGGAAGCAATTTGGAGCACCATTAGCAGCTTTCCAAATCAGTCAACAAAAACTTGTTCAAATGCTAGGTAACATTCAAGCAATGATTCTTGTTGGTTGGCGTCTGTGCAAGTTGTACGAGAGTGGTAAAATGACTCCAGGTCATGCTAGCTTGGGGAAGTCGTGGATTACCCTGAGGGCAAGAGAAACAGCTGCCTTGGGGAGAGAATTGCTTGGTGGCAATGGAATTTTGGCTGATTTTCTAGTGGCAAAGGCATTCTGTGACATAGAACCTATCTACACCTTCGAAGGCACGTATGACATCAACACCTTGGTTACAGGCAGGGAAGTTACTGGTTTTGCCAGCTTTAAGTCGGTTGCTCAGAAAAGTAGGCTGTGA
Predicted protein sequences of Glyma07g18370
>Glyma07g18370.2   sequence type=predicted peptide   gene model=Glyma07g18370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKMPSYFNLPALDVSVAFPQATPASNFPPCASDYFHFNDLLKPEEQAVRNKVRECMEKEIAPIMTEYWEKAEFPFHVIPKFAALRIAGGTIKGYGCPGLSITGSAVATAEVARVDASCSTFYLVHSSLAMLTIALCGSEAQKQKYLPSLAQMKTIACWVGGGWILDGQKRWIGNSTFADLLVIFARNTTTNQINGYIVKKDAPGLTVTKMENKIGLRIVQNGDIVMRKVFVPDDDRIEGVNSFQDTNKVLAVSRVMVAWQPIGLSMGIYDMCHRYLKERKQFGAPLAAFQISQQKLVQMLGNIQAMILVGWRLCKLYESGKMTPGHASLGKSWITLRARETAALGRELLGGNGILADFLVAKAFCDIEPIYTFEGTYDINTLVTGREVTGFASFKSVAQKSRL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo