SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g17180): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g17180): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g17180

Feature Type:gene_model
Chromosome:Gm07
Start:16897586
stop:16900459
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G54050AT Annotation by Michelle Graham. TAIR10: high cyclic electron flow 1 | chr3:20016951-20018527 FORWARD LENGTH=417 SoyBaseE_val: 0ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0005985GO-bp Annotation by Michelle Graham. GO Biological Process: sucrose metabolic process SoyBaseN/AISS
GO:0006000GO-bp Annotation by Michelle Graham. GO Biological Process: fructose metabolic process SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009773GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem I SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0030388GO-bp Annotation by Michelle Graham. GO Biological Process: fructose 1,6-bisphosphate metabolic process SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0042132GO-mf Annotation by Michelle Graham. GO Molecular Function: fructose 1,6-bisphosphate 1-phosphatase activity SoyBaseN/AISS
GO:0042578GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoric ester hydrolase activity SoyBaseN/AISS
KOG1458 KOG Fructose-1,6-bisphosphatase JGI ISS
PTHR11556Panther FRUCTOSE-1,6-BISPHOSPHATASE-RELATED JGI ISS
PTHR11556:SF7Panther SUBFAMILY NOT NAMED JGI ISS
PF00316PFAM Fructose-1-6-bisphosphatase JGI ISS
UniRef100_C6TFM3UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TFM3_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q42796UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fructose-1,6-bisphosphatase, chloroplastic n=1 Tax=Glycine max RepID=F16P1_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g17180 not represented in the dataset

Glyma07g17180 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma18g41940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g142700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g17180.1   sequence type=CDS   gene model=Glyma07g17180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTGCAATGGCAGCAGCAACAGCATCCACCCAGTTGATTTTCTCAAAGCCTTGTTCCCCTTCACGTCTATGCCCCTTCCAACTATGTGTCTTTGACACTAAACAAGTGCTATCAAGTGGCAGGAGAAGGCATGTGGGGGGTTCTGGAGTTAGGTGCATGGCTGTGGGGGAAGCAGCAACCACTGGGACAAAGAAGAGAAGTGGATATGAGCTTCAAACACTCACTAGCTGGTTGCTGAAGCAGGAGCAAGCTGGGGTGATTGATGCAGAACTCACTATTGTGCTGTCTAGCATTTCCATGGCATGCAAACAGATTGCTTCTTTGGTGCAAAGAGCTAACATTTCCAACCTCACTGGGGTTCAAGGTGCTGTCAATGTTCAAGGGGAAGACCAGAAAAAGCTTGATGTTGTTTCAAATGAGGTTTTCTCAAACTGCTTGAGGTCAAGTGGGAGGACAGGGATAATAGCATCAGAGGAGGAAGATGTGCCAGTGGCAGTAGAAGAGAGTTATTCTGGAAACTACATTGTGGTGTTTGACCCACTTGATGGGTCATCCAATATTGATGCTGCAGTGTCAACTGGGTCCATTTTTGGGATATACAGCCCCAATGATGAGTGTCTTGCTGACATTGATGATGACCCCACCCTTGACACAACAGAACAAAGATGTATTGTGAACGTGTGCCAACCTGGAAGCAACCTTCTTGCAGCTGGTTACTGCATGTATTCTAGCTCAATAATCTTTGTTCTCACACTTGGAAATGGAGTGTTTGTGTTTACATTGGACCCGATGTATGGCGAATTCGTTTTGACTCAGGAAAACCTCCAGATACCTAGAGCAGGCAAAATCTATGCATTCAATGAAGGTAATTATCAGTTGTGGGATGAGAAGCTAAAGAAATATATTGATGATCTCAAGGACCCAGGTCCAAGCGGCAAGCCTTATTCTGCAAGGTACATTGGTAGCTTGGTAGGAGATTTCCACAGGACACTGCTATATGGTGGCATTTACGGGTACCCCAGGGACAAGAAAAGCAAGAATGGGAAACTAAGGCTCCTGTATGAATGTGCTCCTATGAGCTTCATTGTAGAACAAGCTGGTGGAAAAGGGTCAGATGGCCATCAAAGAATACTCGACATTCAACCAACAGAGATTCATCAACGTGTGCCACTGTACATTGGGAGCGTTGAAGAGGTAGAGAAGGTGGAAAAGTACTTGGCTTAA

>Glyma07g17180.1   sequence type=predicted peptide   gene model=Glyma07g17180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVAMAAATASTQLIFSKPCSPSRLCPFQLCVFDTKQVLSSGRRRHVGGSGVRCMAVGEAATTGTKKRSGYELQTLTSWLLKQEQAGVIDAELTIVLSSISMACKQIASLVQRANISNLTGVQGAVNVQGEDQKKLDVVSNEVFSNCLRSSGRTGIIASEEEDVPVAVEESYSGNYIVVFDPLDGSSNIDAAVSTGSIFGIYSPNDECLADIDDDPTLDTTEQRCIVNVCQPGSNLLAAGYCMYSSSIIFVLTLGNGVFVFTLDPMYGEFVLTQENLQIPRAGKIYAFNEGNYQLWDEKLKKYIDDLKDPGPSGKPYSARYIGSLVGDFHRTLLYGGIYGYPRDKKSKNGKLRLLYECAPMSFIVEQAGGKGSDGHQRILDIQPTEIHQRVPLYIGSVEEVEKVEKYLA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo