SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g16151

Feature Type:gene_model
Chromosome:Gm07
Start:15876393
stop:15878295
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g16151
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G46620AT Annotation by Michelle Graham. TAIR10: zinc finger (C3HC4-type RING finger) family protein | chr3:17178837-17180024 REVERSE LENGTH=395 SoyBaseE_val: 2.00E-75ISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009612GO-bp Annotation by Michelle Graham. GO Biological Process: response to mechanical stimulus SoyBaseN/AISS
GO:0009693GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0051865GO-bp Annotation by Michelle Graham. GO Biological Process: protein autoubiquitination SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG0320 KOG Predicted E3 ubiquitin ligase JGI ISS
PTHR22763Panther RING ZINC FINGER PROTEIN JGI ISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
PF06547PFAM Protein of unknown function (DUF1117) JGI ISS
UniRef100_B9SZY8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Zinc finger protein, putative n=1 Tax=Ricinus communis RepID=B9SZY8_RICCO SoyBaseE_val: 7.00E-95ISS
UniRef100_UPI0002338D84UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338D84 related cluster n=1 Tax=unknown RepID=UPI0002338D84 SoyBaseE_val: 0ISS

Expression Patterns of Glyma07g16151
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g16151 not represented in the dataset
Glyma07g16151 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g16151
ParalogEvidenceComments
Glyma18g40130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g16151 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g134600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g16151
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma07g16151
>Glyma07g16151.1   sequence type=CDS   gene model=Glyma07g16151   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCACTGGGATCTCCGTCTTCTTTCTGGTGCTACCGCTGCAACCGCATAGTTAGGGTTCCACAAAACCACGCCGTTCTCCTCTGCCCCGATTGCAACTCCGGCTTCCTCGAAGAGCTCCAAACCCCTCCCCACTCGCGCCGATCCACGCGCGGCGGCGGTGGGTCCCCCTTCAACCCGGTAATCGTCCTGCGCAACGCAAACGACGTCGTCTCGCCCGAAACGCGGAACTTCGAACTCTACTACAACGACGCCGTTTCAGGTTCCTCCGGCCCAAGCAGTCTCCGTCCTTTACCACAGGGAGTATCCGAGTTCCTCATGGGCTCCGGCTTCGACAATGTACTCGACCAGCTCGACGCCGCCGCGGGGGGCGCCGGAGCACTGCCCCCCACGGCAGCGTCGAAAGCGGCGATCGAGTCGATGCCGGTGGTTAAGATCCTCGCGAGCCACACCTACGCGGAATCGCACTGCGCGGTCTGCATGGAGAATTTCGAGATCAACTGCGACGCACGTGAGATGCCGTGCGGTCACGTGTACCATTCCGAGTGCATCGTGCCGTGGCTCTCGGTGAGAAACTCGTGCCCCGTGTGCCGCCACGAGGTTCCTTCGGATGAAGTTGAAGAAAGTAATAACAATACTGTGGGGTTGACTATTTGGAGACTTCCTGGGGGAGGATTCGCTGTGGGCAGGTTCATCGGAGGGAGGGAGCTCCCACTGGTGTATACGGAGATGGACGGCGGGTTTAACGGCGCTAACGGCGTTCCAAGGAGAGTCGCTTGGGATAGCTCCGTTGGGAGGTCTAGGGAGAATAGAGGCTTCGGTGCTGCTTTCAGGAATGTTTTTTCGTATATCGGGAGGGTTAGGAGCTCGTTTTCTCGCCGAACGAGAAATTCGCGTGCCAACGGAAGATCTCGTTCTTAA
Predicted protein sequences of Glyma07g16151
>Glyma07g16151.1   sequence type=predicted peptide   gene model=Glyma07g16151   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLGSPSSFWCYRCNRIVRVPQNHAVLLCPDCNSGFLEELQTPPHSRRSTRGGGGSPFNPVIVLRNANDVVSPETRNFELYYNDAVSGSSGPSSLRPLPQGVSEFLMGSGFDNVLDQLDAAAGGAGALPPTAASKAAIESMPVVKILASHTYAESHCAVCMENFEINCDAREMPCGHVYHSECIVPWLSVRNSCPVCRHEVPSDEVEESNNNTVGLTIWRLPGGGFAVGRFIGGRELPLVYTEMDGGFNGANGVPRRVAWDSSVGRSRENRGFGAAFRNVFSYIGRVRSSFSRRTRNSRANGRSRS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo