Glyma07g15850 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g15850

Feature Type:	gene_model
Chromosome:	Gm07
Start:	15553570
stop:	15556706
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g15850

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G37630	AT	Annotation by Michelle Graham. TAIR10: myb-like HTH transcriptional regulator family protein \| chr2:15781798-15782901 REVERSE LENGTH=367	SoyBase	E_val: 1.00E-156	ISS
GO:0008356	GO-bp	Annotation by Michelle Graham. GO Biological Process: asymmetric cell division	SoyBase	N/A	ISS
GO:0009615	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to virus	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009739	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus	SoyBase	N/A	ISS
GO:0009751	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0009944	GO-bp	Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis	SoyBase	N/A	ISS
GO:0009946	GO-bp	Annotation by Michelle Graham. GO Biological Process: proximal/distal axis specification	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0010338	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf formation	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0045088	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0000793	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: condensed chromosome	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005730	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleolus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0042803	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity	SoyBase	N/A	ISS
KOG0048	KOG	Transcription factor, Myb superfamily	JGI		ISS
PTHR10641	Panther	MYB-RELATED	JGI		ISS
PF00249	PFAM	Myb-like DNA-binding domain	JGI		ISS
UniRef100_Q4VPE6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Phantastica transcription factor a n=1 Tax=Glycine max RepID=Q4VPE6_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q4VPE6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Phantastica transcription factor a n=1 Tax=Glycine max RepID=Q4VPE6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma07g15850

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g15850

Paralog	Evidence	Comments
Glyma18g39771	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g15850 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g132400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g15850

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g15850

Limit To All Plant Sequences

>Glyma07g15850.1   sequence type=CDS   gene model=Glyma07g15850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGATAGGCAACGTTGGAGAGCTGAAGAGGATGCTTTACTACGCGCATATGTCAAACAGTATGGTCCTAGGGAATGGAATCTGGTGTCTCAGCGCATGAACACACCTCTTAACAGGGATGCCAAGTCATGCTTAGAAAGGTGGAAGAACTACCTCAAGCCCGGCATTAAGAAAGGATCTCTTACAGAGGAAGAGCAGCGTCTAGTCATCAACCTTCAAGCAACACACGGCAACAAGTGGAAGAAAATTGCAGCACAAGTCCCTGGTCGCACAGCAAAGAGGTTAGGGAAGTGGTGGGAAGTGTTCAAAGAGAAGCAGCAAAGGGAAACAAAGGGGAATAACTGCACCATTGACCCAATTAACGATAGCAAGTACGAGCATATCCTTGAGAGTTTTGCAGAGAAGCTAGTGAAAGAAAGGCCTTCAACATCAACATCAACATCATTTGTTATGGCTACTTCCAACAGTTCTTTTCTGCATGCTGATGCACCGGCTCCTGCACCAGCCTTGCTTCCGTCTTGGCTTTCCAATTCCAATGGCACTGCACCTGTGAGGCCACCCTCCCCTTCTGTGACTCTTAGTCTTTCTCCCTCGACGGTGGCAGCGCCTCCTCCATGGATGCAGCCCCCCGTCAGAGGACAGGACAATGCTAGTCCTCTTGTTTTGGGGAATGTGGCGCCTCACGGGGCCGTTCTAGCATTTGGTGAGAACATGGTGATGTCTGAGCTAGTGGAGTGCTGCAAGGAGTTGGATGAAGTGCATCATGCTTTGGCCGGGCATAAGAAGGAGGCAGCATGGCGGTTAAGCAGGGTGGAGCTGCAGTTGGAGTCTGAGAAGGCTGGGCGAAGGAGGGAGAAGATGGAGGAAATCGAAGCGAAAATCAAAGCTCTGAGGGAGGAGCAAACGGCTGCATTGGATAGAATTGAAGCAGAATATAGGGAGCAGTTGGCAGGGCTGAGAAGAGATGCTGAAAGCAAGGAGCAAAAGTTGGCTGAACAATGGGCTGCAAAACACTTGCGACTTACTAAGTTTCTAGAACAGGTAGGGTGCAGATCAAGGCTCACTGAACCAAATGGAAGATAG

Predicted protein sequences of Glyma07g15850

Limit To All Plant Sequences

>Glyma07g15850.1   sequence type=predicted peptide   gene model=Glyma07g15850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKDRQRWRAEEDALLRAYVKQYGPREWNLVSQRMNTPLNRDAKSCLERWKNYLKPGIKKGSLTEEEQRLVINLQATHGNKWKKIAAQVPGRTAKRLGKWWEVFKEKQQRETKGNNCTIDPINDSKYEHILESFAEKLVKERPSTSTSTSFVMATSNSSFLHADAPAPAPALLPSWLSNSNGTAPVRPPSPSVTLSLSPSTVAAPPPWMQPPVRGQDNASPLVLGNVAPHGAVLAFGENMVMSELVECCKELDEVHHALAGHKKEAAWRLSRVELQLESEKAGRRREKMEEIEAKIKALREEQTAALDRIEAEYREQLAGLRRDAESKEQKLAEQWAAKHLRLTKFLEQVGCRSRLTEPNGR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain