|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G65060 | AT | Annotation by Michelle Graham. TAIR10: 4-coumarate:CoA ligase 3 | chr1:24167927-24171457 REVERSE LENGTH=495 | SoyBase | E_val: 1.00E-15 | ISS |
| GO:0008152 | GO-bp | Annotation by Michelle Graham. GO Biological Process: metabolic process | SoyBase | N/A | ISS |
| GO:0009411 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to UV | SoyBase | N/A | ISS |
| GO:0009698 | GO-bp | Annotation by Michelle Graham. GO Biological Process: phenylpropanoid metabolic process | SoyBase | N/A | ISS |
| GO:0009718 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anthocyanin-containing compound biosynthetic process | SoyBase | N/A | ISS |
| GO:0009744 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus | SoyBase | N/A | ISS |
| GO:0009813 | GO-bp | Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process | SoyBase | N/A | ISS |
| GO:0010224 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to UV-B | SoyBase | N/A | ISS |
| GO:0010584 | GO-bp | Annotation by Michelle Graham. GO Biological Process: pollen exine formation | SoyBase | N/A | ISS |
| GO:0005575 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cellular component | SoyBase | N/A | ISS |
| GO:0003824 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: catalytic activity | SoyBase | N/A | ISS |
| GO:0016207 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: 4-coumarate-CoA ligase activity | SoyBase | N/A | ISS |
| UniRef100_Q8S5C2 | UniRef | Annotation by Michelle Graham. Best UniRef hit: 4-coumarate:CoA ligase isoenzyme 3 n=1 Tax=Glycine max RepID=Q8S5C2_SOYBN | SoyBase | E_val: 1.00E-33 | ISS |
| UniRef100_Q8S5C2 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: 4-coumarate:CoA ligase isoenzyme 3 n=1 Tax=Glycine max RepID=Q8S5C2_SOYBN | SoyBase | E_val: 1.00E-33 | ISS |
|
Glyma07g14234 not represented in the dataset |
Glyma07g14234 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.07g112700 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma07g14234.1 sequence type=CDS gene model=Glyma07g14234 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGATAATTGTAGCGCCTTCTCTTGATGCCAAAGAGGTGTCAACCCCAAAAACTGATCAAAACCAAGTTTGTGATCCCCAAACTAGCCATGTCTTCAAATCAAAATTATCAGATATACCAATCTCCAACCACCTCCCTCTCCACGCCTACTGCTTTGAGAACCTCTCCGAATTTGCCGACTGGCCATGCCTTATGTCGGACCTGTCGAAAAAACCTTCACCTATGACGAGATGCACCTCATTTCCTGCAAGATCATCGTCGGATTGTCCAACCTCAAAATCTACAAGGAACTCTGTTGAGTTCGTCTTCTCCTTCCTCGTCGCCTCCATGATCAACGTTGTTGCCACCATCGCCGCACACCTACATGCCTTGTGGCGGTTAGGACATTCAGGGTGCCCTGAACCGTGGGTTTGA
>Glyma07g14234.1 sequence type=predicted peptide gene model=Glyma07g14234 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MIIVAPSLDAKEVSTPKTDQNQVCDPQTSHVFKSKLSDIPISNHLPLHAYCFENLSEFADWPCLMSDLSKKPSPMTRCTSFPARSSSDCPTSKSTRNSVEFVFSFLVASMINVVATIAAHLHALWRLGHSGCPEPWV*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||