SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g11020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g11020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g11020

Feature Type:gene_model
Chromosome:Gm07
Start:9220544
stop:9220888
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G11160AT Annotation by Michelle Graham. TAIR10: Translation initiation factor 2, small GTP-binding protein | chr4:6803846-6806726 FORWARD LENGTH=743 SoyBaseE_val: 2.00E-44ISS
GO:0006413GO-bp Annotation by Michelle Graham. GO Biological Process: translational initiation SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016926GO-bp Annotation by Michelle Graham. GO Biological Process: protein desumoylation SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0050665GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0003743GO-mf Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
PTHR23115Panther TRANSLATION FACTOR JGI ISS
PTHR23115:SF41Panther JGI ISS
PF00009PFAM Elongation factor Tu GTP binding domain JGI ISS
UniRef100_D7U9V2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Translation initiation factor IF-2 n=1 Tax=Vitis vinifera RepID=D7U9V2_VITVI SoyBaseE_val: 4.00E-50ISS
UniRef100_I1NBL5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NBL5_SOYBN SoyBaseE_val: 3.00E-57ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g11020 not represented in the dataset

Glyma07g11020 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g098400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g11020.1   sequence type=CDS   gene model=Glyma07g11020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCATGCAAAAGCAAATATTGTACCAATTGTAGTTGCCATTAACAAATGTGATAAAGCAGGTGCAAATTCTGAAAAAGTTAAACTGCAGCTTGCTTCAGAGGGCTTGCTTCTAGAGGAGATGGGTGGGGATGTTCAAGTTGTTGAGGTTTCAGCAACTGAAAAAATTGGTCTGGATAACCTAGAAGAAGCTTTACTACTTCAGGCTGATATGATGGATCTTAAAGCACGAATTCATGGGCTTGCTCAAGCAAATGTGATGGAAGCGAGACTTGACAAAGGACGGGGTCCATTAGTAACTACTATAGTGAAGGCAGGGACTCTTTTCAATTTGTTGTTTTAA

>Glyma07g11020.1   sequence type=predicted peptide   gene model=Glyma07g11020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSHAKANIVPIVVAINKCDKAGANSEKVKLQLASEGLLLEEMGGDVQVVEVSATEKIGLDNLEEALLLQADMMDLKARIHGLAQANVMEARLDKGRGPLVTTIVKAGTLFNLLF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo