Glyma07g11020 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g11020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g11020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g11020

Feature Type:	gene_model
Chromosome:	Gm07
Start:	9220544
stop:	9220888
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g11020

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G11160	AT	Annotation by Michelle Graham. TAIR10: Translation initiation factor 2, small GTP-binding protein \| chr4:6803846-6806726 FORWARD LENGTH=743	SoyBase	E_val: 2.00E-44	ISS
GO:0006413	GO-bp	Annotation by Michelle Graham. GO Biological Process: translational initiation	SoyBase	N/A	ISS
GO:0009165	GO-bp	Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009887	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ morphogenesis	SoyBase	N/A	ISS
GO:0009888	GO-bp	Annotation by Michelle Graham. GO Biological Process: tissue development	SoyBase	N/A	ISS
GO:0010228	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem	SoyBase	N/A	ISS
GO:0010638	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization	SoyBase	N/A	ISS
GO:0016926	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein desumoylation	SoyBase	N/A	ISS
GO:0033044	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization	SoyBase	N/A	ISS
GO:0050665	GO-bp	Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0003743	GO-mf	Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity	SoyBase	N/A	ISS
GO:0003924	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTPase activity	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
PTHR23115	Panther	TRANSLATION FACTOR	JGI		ISS
PTHR23115:SF41	Panther		JGI		ISS
PF00009	PFAM	Elongation factor Tu GTP binding domain	JGI		ISS
UniRef100_D7U9V2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Translation initiation factor IF-2 n=1 Tax=Vitis vinifera RepID=D7U9V2_VITVI	SoyBase	E_val: 4.00E-50	ISS
UniRef100_I1NBL5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NBL5_SOYBN	SoyBase	E_val: 3.00E-57	ISS

Expression Patterns of Glyma07g11020

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g11020 not represented in the dataset	Glyma07g11020 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma07g11020 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.07g098400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma07g11020

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g11020

Limit To All Plant Sequences

>Glyma07g11020.1   sequence type=CDS   gene model=Glyma07g11020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCATGCAAAAGCAAATATTGTACCAATTGTAGTTGCCATTAACAAATGTGATAAAGCAGGTGCAAATTCTGAAAAAGTTAAACTGCAGCTTGCTTCAGAGGGCTTGCTTCTAGAGGAGATGGGTGGGGATGTTCAAGTTGTTGAGGTTTCAGCAACTGAAAAAATTGGTCTGGATAACCTAGAAGAAGCTTTACTACTTCAGGCTGATATGATGGATCTTAAAGCACGAATTCATGGGCTTGCTCAAGCAAATGTGATGGAAGCGAGACTTGACAAAGGACGGGGTCCATTAGTAACTACTATAGTGAAGGCAGGGACTCTTTTCAATTTGTTGTTTTAA

Predicted protein sequences of Glyma07g11020

Limit To All Plant Sequences

>Glyma07g11020.1   sequence type=predicted peptide   gene model=Glyma07g11020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSHAKANIVPIVVAINKCDKAGANSEKVKLQLASEGLLLEEMGGDVQVVEVSATEKIGLDNLEEALLLQADMMDLKARIHGLAQANVMEARLDKGRGPLVTTIVKAGTLFNLLF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain