Report for Sequence Feature Glyma07g10870
Feature Type: gene_model
Chromosome: Gm07
Start: 9082038
stop: 9084574
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma07g10870
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G18260 AT
Annotation by Michelle Graham. TAIR10: Reticulon family protein | chr3:6260328-6261504 REVERSE LENGTH=225
SoyBase E_val: 2.00E-81 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0005783 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
KOG1792
KOG
Reticulon
JGI ISS
PTHR10994 Panther
RETICULON/NOGO
JGI ISS
PTHR10994:SF27 Panther
RETICULON-RELATED (PLANT)
JGI ISS
PF02453 PFAM
Reticulon
JGI ISS
UniRef100_I1KJ13 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KJ13_SOYBN
SoyBase E_val: 5.00E-161 ISS
UniRef100_Q9LJQ5 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Reticulon-like protein B9 n=1 Tax=Arabidopsis thaliana RepID=RTNLI_ARATH
SoyBase E_val: 9.00E-79 ISS
Expression Patterns of Glyma07g10870
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma07g10870
Paralog Evidence Comments
Glyma09g31220 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma07g10870 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.07g097100 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma07g10870
Coding sequences of Glyma07g10870
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma07g10870.1 sequence type=CDS gene model=Glyma07g10870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCGCACGATACATCATCTGATTCTGAAAATGAAATTATTGGAGCACGGGCAAAGCTCTTTGGACATGAAAAACCGATTCATGAAGTTCTTGGAGGAGGAAAAGTGGCAGATATGTTATTATGGAGGGACAGATATGTATCAGGTGCGCTTTTGGGTGGGATGACTGTGATATGGTTTCTATTTGAGATCGTTGAGTACAATTTCGTGGCACTCCTTTGTCACATTTCCATCACCACCATGCTTGTTCTATTCATATGGTCCACGGTTGCAGATATATTTAAATGGAAAGGTCCCCAGATCCCAAACATTGTTTTACAGGAATCTTTCTTCCATGATCTTGCTTCCATCCTCCACAAAAGATTTAACCAGTTATTACCAATGCTCCTCCACATTTCATGTGGAATAGACCTGCCAATCTTTCTTCTGAACATTGTTTCTCTCTATATTCTGTCAGTGATTGGAAGCTACTTCAGTTTTGTCAATCTGCTATATATTGGGTTTCTCTGCATGCAAACGCTGCCAATTGTGTATGAACGGTATGAGGAAGAAATCAACAATTGGGTCAGCGATATCATAATAGTTATAAGGAAAAACTATAGGAGGTTTAACAAGAACTACCTCAACAAAATTCCCAGAGGACCAGTGAAGGCAAAGAAAACCCAATAA
Predicted protein sequences of Glyma07g10870
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma07g10870.1 sequence type=predicted peptide gene model=Glyma07g10870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAHDTSSDSENEIIGARAKLFGHEKPIHEVLGGGKVADMLLWRDRYVSGALLGGMTVIWFLFEIVEYNFVALLCHISITTMLVLFIWSTVADIFKWKGPQIPNIVLQESFFHDLASILHKRFNQLLPMLLHISCGIDLPIFLLNIVSLYILSVIGSYFSFVNLLYIGFLCMQTLPIVYERYEEEINNWVSDIIIVIRKNYRRFNKNYLNKIPRGPVKAKKTQ*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
