SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g09000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g09000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g09000

Feature Type:gene_model
Chromosome:Gm07
Start:7503094
stop:7506283
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G45630AT Annotation by Michelle Graham. TAIR10: D-isomer specific 2-hydroxyacid dehydrogenase family protein | chr2:18796000-18797089 FORWARD LENGTH=338 SoyBaseE_val: 1.00E-116ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0048037GO-mf Annotation by Michelle Graham. GO Molecular Function: cofactor binding SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG0069 KOG Glyoxylate/hydroxypyruvate reductase (D-isomer-specific 2-hydroxy acid dehydrogenase superfamily) JGI ISS
PTHR10996Panther 2-HYDROXYACID DEHYDROGENASE JGI ISS
PTHR10996:SF15Panther 2-HYDROXYACID DEHYDROGENASE-RELATED JGI ISS
PF00389PFAM D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain JGI ISS
PF02826PFAM D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain JGI ISS
UniRef100_B9RDG8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycerate dehydrogenase, putative n=1 Tax=Ricinus communis RepID=B9RDG8_RICCO SoyBaseE_val: 2.00E-119ISS
UniRef100_I1KIL1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KIL1_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g09000 not represented in the dataset

Glyma07g09000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g082100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g09000.1   sequence type=CDS   gene model=Glyma07g09000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGACCAAAACCAGTGTACTACAAGGGACGAACAATTAAAAAACCTTAATCTCCCCAAAGTCCTAATTCACGGTCCCCCAGGTTTTTCCTCTGTTCTCCAACCACCCTTTTCCCAAAAGTTTCATATTTTAAACCACTCTTCTCTTCCCCTGCACAAGTTCGCGGCCACCCACGCCCACCACTGTTCCTCCGTCGCCGCCGTGCTCTGCGACGGCGGCTACCCCGTCACTGCCGACGTCCTCCGCCTCCTCCCTTCGCTCCGCCTTCTCGTCACCGCCAGCGCCGGCACCGATCATGTCGACCTGGAGGAGTGTCGCCGCCTGGGAGTCCGCGTCGCCGGCGCCGGAAACATGTTCTCTGAGGACGTTGCCGACTTAGCGGTGGGTTTGTTGATTGACGTGATGATGAAAATTTCCGCGGCGAATCGGTGTCTGAGAGAACGGATTCTGGTAGTTTCACGGGATTTTCCACTTGCTTCTATTTTTAAGTTGACAGGAAAGAAAGTTGGAATTGTTGGTCTGGGAAAAATTGGCTTAGAAGTGGCACATAGGCTTGAGGCTTTTGGTTGCATGATATCATACAACTCTAGGAGCAAAAAAACCTTTGTTTCCTACCCTTTCTATTCTAGTGTTGTTGAGCTTGCCACTAACAACAATGTACTTGTTCTTTGTTGTGCTCTTAATGACCAAACGAGGCACATGATCAACAGAGAAGTCATGTTGGCACTGGGAAAAGGAGGAATTATCGTGAATGTGGCAAGAGGGGCTTTGATATATGAAAAGGAATTGTTGAGGTGTTTGATGGAAAGGGAAATTGGAGGTGCTGGTTTGGATGTGTTTGAGAATGAACCTCTTGTGTGTGAAGAGTTCTTTTCGTTGGATAATGTAGTTCTATCTCCACATGCAGGTTTTTCCACGTTAGAGTCTCATGATGGTATTTGTCAACTTGTGGGACGCAATTTAGAAGCTTTTTTCTCTAACAAGCCTCTAATTACTCCAATCATATAG

>Glyma07g09000.1   sequence type=predicted peptide   gene model=Glyma07g09000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEDQNQCTTRDEQLKNLNLPKVLIHGPPGFSSVLQPPFSQKFHILNHSSLPLHKFAATHAHHCSSVAAVLCDGGYPVTADVLRLLPSLRLLVTASAGTDHVDLEECRRLGVRVAGAGNMFSEDVADLAVGLLIDVMMKISAANRCLRERILVVSRDFPLASIFKLTGKKVGIVGLGKIGLEVAHRLEAFGCMISYNSRSKKTFVSYPFYSSVVELATNNNVLVLCCALNDQTRHMINREVMLALGKGGIIVNVARGALIYEKELLRCLMEREIGGAGLDVFENEPLVCEEFFSLDNVVLSPHAGFSTLESHDGICQLVGRNLEAFFSNKPLITPII*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo