SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g08831

Feature Type:gene_model
Chromosome:Gm07
Start:7342088
stop:7366452
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g08831
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G45660AT Annotation by Michelle Graham. TAIR10: AGAMOUS-like 20 | chr2:18807799-18810193 REVERSE LENGTH=214 SoyBaseE_val: 2.00E-91ISS
GO:0000060GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus, translocation SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009908GO-bp Annotation by Michelle Graham. GO Biological Process: flower development SoyBaseN/AISS
GO:0009911GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flower development SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0010077GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of inflorescence meristem identity SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048440GO-bp Annotation by Michelle Graham. GO Biological Process: carpel development SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008134GO-mf Annotation by Michelle Graham. GO Molecular Function: transcription factor binding SoyBaseN/AISS
KOG0014 KOG MADS box transcription factor JGI ISS
PTHR11945Panther MADS BOX PROTEIN JGI ISS
PTHR11945:SF19Panther MADS BOX PROTEIN JGI ISS
PF00319PFAM SRF-type transcription factor (DNA-binding and dimerisation domain) JGI ISS
PF01486PFAM K-box region JGI ISS
UniRef100_A1XG54UniRef Annotation by Michelle Graham. Most informative UniRef hit: SOC1 n=1 Tax=Glycine max RepID=A1XG54_SOYBN SoyBaseE_val: 4.00E-107ISS
UniRef100_UPI0002338DAFUniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338DAF related cluster n=1 Tax=unknown RepID=UPI0002338DAF SoyBaseE_val: 3.00E-156ISS

Expression Patterns of Glyma07g08831
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g08831 not represented in the dataset
Glyma07g08831 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g08831
ParalogEvidenceComments
Glyma03g02191 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g08831 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g080900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g08831
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Transcripts of Glyma07g08831
>Glyma07g08831.2   sequence type=transcript   gene model=Glyma07g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CCTTTTCATTTTTTATTTTCTTAGCTTGTCGTCAAACATAACCCTTGGAAGACATTGATCATGTCCTTGTCTATATATGTTCTCATTTTCTAAGTGCTGATTTACTTAATATTGGCTTTAATGATACAGCATGCAGGAGTCAATTGAACGATACCGCAGGCATACCAAGCATGTTAATCCAACTACATTCAGATCAGTTGAACAAAATATGCAGCATCTGAAGCAAGAGGCAGAAAACATGATGAAGAAGATTGACCTTCTTGAAGCTGCAAAACGGAAGTTCTTGGGGGAAGGTTTGGGGGCTTGCTCCATTGAGGAACTGCAACGGATAGAACAACAGTTGGAGAGGAGTTTAAGTAATGTTAGAGCAAGAAAGGTCCAGGTTTTCAAGGAACAAATTGAACAACTAAAAGAAAAGGAAAAAGCCCTACTAGATGAAAATGCCAAGCTCACTGAAAATGCCAGGCTCTCTGAGAAGCATGACATCCATCTACAGCCAGCAACAAAGAATCAGAATGTGAATCAACCCCAATGCAATGCAGAAAGTAGTTCAAGTTCAGATGTGGAGACCGAATTGTTCATTGGACTTCCTGATACAAGAGCAAGACACATCTCTCATCACGTCTAGTAGAAGATTACTTATTCCCTGGCTATGGAAAATAAAATAAGGGTACTTGGAAGCATGAGGAGGGACAATGTCATGAAATTTTCGCACAACAGAATTATAATTACACCTATTTTAATATGTAATTATTCGTTTCTACTTTCTCAATTCCAATAAAAAAAAATGCAAGCTCCAATATATTGTAGTGAGATTTGAATTGGACTGGTCCCAAAATTGGCAGGTAAGATGATCAGGAGTGTTCAAAACTAAACTCCATCATTTGTAAACCGCAAAATCGATTCAAAAAAATTGAAAATCACTTAGATCAAAAACTGTAAAAAAAA
Coding sequences of Glyma07g08831
>Glyma07g08831.1   sequence type=CDS   gene model=Glyma07g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGAGGGGAAAGACTCAGATGAAGCGTATAGAGAATGCCACAAGCAGGCAAGTAACTTTCTCAAAGCGGCGAAATGGGTTGCTGAAGAAGGCCTTTGAGCTATCAGTTCTGTGTGATGCTGAGGTTGCTCTAATCATCTTCTCTCCAAGAGGGAAGCTCTATGAATTTGCTAGCTCCAGCATGCAGGAGTCAATTGAACGATACCGCAGGCATACCAAGCATGTTAATCCAACTACATTCAGATCAGTTGAACAAAATATGCAGCATCTGAAGCAAGAGGCAGAAAACATGATGAAGAAGATTGACCTTCTTGAAGCTGCAAAACGGAAGTTCTTGGGGGAAGGTTTGGGGGCTTGCTCCATTGAGGAACTGCAACGGATAGAACAACAGTTGGAGAGGAGTTTAAGTAATGTTAGAGCAAGAAAGGTCCAGGTTTTCAAGGAACAAATTGAACAACTAAAAGAAAAGGAAAAAGCCCTACTAGATGAAAATGCCAAGCTCACTGAAAATGCCAGGCTCTCTGAGAAGCATGACATCCATCTACAGCCAGCAACAAAGAATCAGAATGTGAATCAACCCCAATGCAATGCAGAAAGTAGTTCAAGTTCAGATGTGGAGACCGAATTGTTCATTGGACTTCCTGATACAAGAGCAAGACACATCTCTCATCACGTCTAG

>Glyma07g08831.2   sequence type=CDS   gene model=Glyma07g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAGGAGTCAATTGAACGATACCGCAGGCATACCAAGCATGTTAATCCAACTACATTCAGATCAGTTGAACAAAATATGCAGCATCTGAAGCAAGAGGCAGAAAACATGATGAAGAAGATTGACCTTCTTGAAGCTGCAAAACGGAAGTTCTTGGGGGAAGGTTTGGGGGCTTGCTCCATTGAGGAACTGCAACGGATAGAACAACAGTTGGAGAGGAGTTTAAGTAATGTTAGAGCAAGAAAGGTCCAGGTTTTCAAGGAACAAATTGAACAACTAAAAGAAAAGGAAAAAGCCCTACTAGATGAAAATGCCAAGCTCACTGAAAATGCCAGGCTCTCTGAGAAGCATGACATCCATCTACAGCCAGCAACAAAGAATCAGAATGTGAATCAACCCCAATGCAATGCAGAAAGTAGTTCAAGTTCAGATGTGGAGACCGAATTGTTCATTGGACTTCCTGATACAAGAGCAAGACACATCTCTCATCACGTCTAG
Predicted protein sequences of Glyma07g08831
>Glyma07g08831.1   sequence type=predicted peptide   gene model=Glyma07g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVRGKTQMKRIENATSRQVTFSKRRNGLLKKAFELSVLCDAEVALIIFSPRGKLYEFASSSMQESIERYRRHTKHVNPTTFRSVEQNMQHLKQEAENMMKKIDLLEAAKRKFLGEGLGACSIEELQRIEQQLERSLSNVRARKVQVFKEQIEQLKEKEKALLDENAKLTENARLSEKHDIHLQPATKNQNVNQPQCNAESSSSSDVETELFIGLPDTRARHISHHV*

>Glyma07g08831.2   sequence type=predicted peptide   gene model=Glyma07g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQESIERYRRHTKHVNPTTFRSVEQNMQHLKQEAENMMKKIDLLEAAKRKFLGEGLGACSIEELQRIEQQLERSLSNVRARKVQVFKEQIEQLKEKEKALLDENAKLTENARLSEKHDIHLQPATKNQNVNQPQCNAESSSSSDVETELFIGLPDTRARHISHHV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo