SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g08550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g08550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g08550

Feature Type:gene_model
Chromosome:Gm07
Start:7136168
stop:7139017
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36870AT Annotation by Michelle Graham. TAIR10: xyloglucan endotransglucosylase/hydrolase 32 | chr2:15472869-15474630 REVERSE LENGTH=299 SoyBaseE_val: 1.00E-23ISS
GO:0016998GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process SoyBaseN/AISS
GO:0042546GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0016762GO-mf Annotation by Michelle Graham. GO Molecular Function: xyloglucan:xyloglucosyl transferase activity SoyBaseN/AISS
GO:0016798GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on glycosyl bonds SoyBaseN/AISS
PTHR10963Panther SECRETED GLUCOSIDASE-RELATED JGI ISS
PTHR10963:SF14Panther BETA-GLUCANASE JGI ISS
PF00722PFAM Glycosyl hydrolases family 16 JGI ISS
PF06839PFAM GRF zinc finger JGI ISS
UniRef100_B6TNS1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Xyloglucan endotransglucosylase/hydrolase protein 5 n=1 Tax=Zea mays RepID=B6TNS1_MAIZE SoyBaseE_val: 3.00E-69ISS
UniRef100_I1KII1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KII1_SOYBN SoyBaseE_val: 6.00E-164ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g08550 not represented in the dataset

Glyma07g08550 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma03g01941 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g078700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g08550.2   sequence type=CDS   gene model=Glyma07g08550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGCTAATTCAAGCACAAAGGGGAATGCCACGTCAAACTGTCTTTGCTATTGTCGTAGAAGAGCTACCATTCGAATAGCAAGGACGACAAGAAATAATCGGAGACTGTTTTATGCTTGTCCATTACCACAATTAAATACGCATGCATTCCAATTCTCAGCTCTGGAATCTTCATTTCACATTCCAATGGCCGATGCAGCGACCCAACCTTTGAAGGAGATTGCGATCGACTACACCCCCGAGGCCTGTTCCCACTGCGCCACCTCCAACACCATCACCCTCACCTACGACCACCGCGGCGGCGCGCGGTGGCGCACCGCCTCCCGCTTCCGCTCCGGTACGTTCTCCGCCCTCATCCGGTGTCCCTCCGGCGACACGAGCGGCCTCAACTTCAACCTCTACCTCTCCTCCCTGGAGGGCGACAAGTCCCAGGACGAGATCGACTTCGAGTTTCTGGGCCGCGACAGGACCATCGTACAAACGAACTTCTACTCCGAAGGCGCAGGAAACAAGGAGAGGATTCACCATTTAGGGTTCGATGCTTCCGATGGGTTTCATGAGTACGTGATTGTGTGGGGGAGCGACGCGATCGAGTGGCGCGTGGATGGGAAGGTGGTGAGGAGGGAGGAGAGGAAGGAGGGGGAGGGGTTTCCGGAGAAGGCTATGTTTTTGTACGCTTCGGTGTGGGATGCAAGTTGGGTTGCTGAAGGGAAAGTGGTGTGGGGAAGTACTGTGGGGGTGATGAGCCTTATGTTTGTGTCTAGGGGACATTCGTGTTCCCGTTGGAACTTCTGTTGTGGATTGAGTATTCACCTCTTTTTTATCGATAATTTTTCTCCTTCTAAGAGACATTTGGAAGCTCCAAACATAAATTAA

>Glyma07g08550.2   sequence type=predicted peptide   gene model=Glyma07g08550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSANSSTKGNATSNCLCYCRRRATIRIARTTRNNRRLFYACPLPQLNTHAFQFSALESSFHIPMADAATQPLKEIAIDYTPEACSHCATSNTITLTYDHRGGARWRTASRFRSGTFSALIRCPSGDTSGLNFNLYLSSLEGDKSQDEIDFEFLGRDRTIVQTNFYSEGAGNKERIHHLGFDASDGFHEYVIVWGSDAIEWRVDGKVVRREERKEGEGFPEKAMFLYASVWDASWVAEGKVVWGSTVGVMSLMFVSRGHSCSRWNFCCGLSIHLFFIDNFSPSKRHLEAPNIN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo