SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g08240): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g08240): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g08240

Feature Type:gene_model
Chromosome:Gm07
Start:6837072
stop:6844618
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G45770AT Annotation by Michelle Graham. TAIR10: signal recognition particle receptor protein, chloroplast (FTSY) | chr2:18851248-18853402 FORWARD LENGTH=366 SoyBaseE_val: 0ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006605GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting SoyBaseN/AISS
GO:0006614GO-bp Annotation by Michelle Graham. GO Biological Process: SRP-dependent cotranslational protein targeting to membrane SoyBaseN/AISS
GO:0009772GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem II SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045038GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into chloroplast thylakoid membrane SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0051607GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to virus SoyBaseN/AISS
GO:0005786GO-cc Annotation by Michelle Graham. GO Cellular Compartment: signal recognition particle, endoplasmic reticulum targeting SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
PTHR11564Panther GTPASE CONTAINING FAMILY OF SIGNAL RECOGNITION PARTICLE PROTEINS JGI ISS
PTHR11564:SF10Panther SUBFAMILY NOT NAMED JGI ISS
PF00448PFAM SRP54-type protein, GTPase domain JGI ISS
PF02881PFAM SRP54-type protein, helical bundle domain JGI ISS
UniRef100_B9RDL9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cell division protein ftsy, putative n=1 Tax=Ricinus communis RepID=B9RDL9_RICCO SoyBaseE_val: 0ISS
UniRef100_I1KIG1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KIG1_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g08240 not represented in the dataset

Glyma07g08240 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma03g01770 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g075900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g08240.1   sequence type=CDS   gene model=Glyma07g08240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCACCACTTCTGCTTCATTCGCGAGCTTCTCCGTCATCTTGCGACCTTCTTCGTCCAATCCCCAATTCTTCCTCTTCAACGTCGCTCCCCGAACCGGAACCTCTCATTCCCGAACCCGTTCGACTCGGTTCAGGTGCTCGGCCGGTCAGACCGGGTTCTTCACGAAACTAGGGCGGTTGATAAAGGAGAAGGCGAAGAGCGACGTGGAGAAGCTTTTCTCGGGATTCTCCAAGACCCGCAGCAACCTCGCCGTCATCGACGAGCTTCTCCTCTATTGGAACCTCGCCGACACCGATCGGGTCCTCGACGAACTCGAAGAGGCTCTTTTAGTGTCTGATTTTGGTCCAAGAATCACTATTAAAATAGTGGAGAATTTGCGCGAGGATATATTTTCAGGGAAGCTTAAATCAGGGAATGAGATAAAGGAAGCACTGAAGAGGAATGTTTTGGAATTATTAACCTCCAAGGGGAGTAAAACTGAACTTCAACTTGGATACAGGAAGCCAGCTGTAATAATGATAGTTGGTGTTAACGGTGGAGGGAAGACTACATCTTTGGGAAAGCTGGCCTATAGATTGAAGAATGAAGGGGCTAAGATATTGATGGCTGCTGGTGATACATTTAGAGCAGCTGCTAGTGATCAGTTGGAAATATGGGCCGGACGGACTGGGTGTGAGATTGTTGTGGCTGAATCAGAGAAAGCAAAAGCATCATCAGTGCTTTCACAGGCTGTAAAAAAGGGAAAAGAGCTAGGTTTTGATATTGTATTATGTGATACATCTGGGCGTTTACACACTAATTACAGCTTAATGGAAGAGTTGATTTCCTGTAAAAAATCTGTTGCTAAGGTCATTCCTGGCGCACCTAATGAGATCCTACTGGTTCTGGATGGGACTACCGGTTTGAATATGTTGCCACAAGCAAGAGAATTCAATGATGTTGTGGGTGTTACTGGTTTAATTTTGACCAAACTGGATGGTTCTGCTAGAGGTGGCTGTGTGGTCAGTGTGGTTGATGAGCTTGGAATCCCTGTAAAATTTGTGGGTGTTGGTGAAGGTGTTGAAGACCTTCAACCCTTTGATGCGGAGTCCTTTGTGAATGCCATTTTTATTTAA

>Glyma07g08240.1   sequence type=predicted peptide   gene model=Glyma07g08240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATTSASFASFSVILRPSSSNPQFFLFNVAPRTGTSHSRTRSTRFRCSAGQTGFFTKLGRLIKEKAKSDVEKLFSGFSKTRSNLAVIDELLLYWNLADTDRVLDELEEALLVSDFGPRITIKIVENLREDIFSGKLKSGNEIKEALKRNVLELLTSKGSKTELQLGYRKPAVIMIVGVNGGGKTTSLGKLAYRLKNEGAKILMAAGDTFRAAASDQLEIWAGRTGCEIVVAESEKAKASSVLSQAVKKGKELGFDIVLCDTSGRLHTNYSLMEELISCKKSVAKVIPGAPNEILLVLDGTTGLNMLPQAREFNDVVGVTGLILTKLDGSARGGCVVSVVDELGIPVKFVGVGEGVEDLQPFDAESFVNAIFI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo