SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g06480): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g06480): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g06480

Feature Type:gene_model
Chromosome:Gm07
Start:5225951
stop:5227712
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G56760AT Annotation by Michelle Graham. TAIR10: serine acetyltransferase 1;1 | chr5:22961498-22962582 REVERSE LENGTH=312 SoyBaseE_val: 2.00E-168ISS
GO:0006535GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process from serine SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009001GO-mf Annotation by Michelle Graham. GO Molecular Function: serine O-acetyltransferase activity SoyBaseN/AISS
GO:0016740GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity SoyBaseN/AISS
KOG4750 KOG Serine O-acetyltransferase JGI ISS
PTHR23416Panther SIALIC ACID SYNTHASE-RELATED JGI ISS
PTHR23416:SF18Panther SUBFAMILY NOT NAMED JGI ISS
PF00132PFAM Bacterial transferase hexapeptide (three repeats) JGI ISS
PF06426PFAM Serine acetyltransferase, N-terminal JGI ISS
UniRef100_I1KHY6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KHY6_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q39533UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine acetyltransferase n=1 Tax=Citrullus lanatus RepID=Q39533_CITLA SoyBaseE_val: 3.00E-178ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g06480 not represented in the dataset

Glyma07g06480 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma16g03080 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g058800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g06480.1   sequence type=CDS   gene model=Glyma07g06480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGACGGGGTTACCGAAGGCGAACTCCTCCGTGGCGCCGGACGACCAGGGATGGTTGTGGACGCAGATCAAGGCGGAGGCGCGCCGTGACGCCGAGTTGGAGCCGGCGCTGGCGAGCTACCTCTACTCGACGATCCTCTCGCACTCGTCGCTCGTGCGCTCTCTGTCTTTTCACCTCGGAAACAAGCTCTGTTCCTCCACGCTCCTCTCCACTCTCCTCTATGACCTGTTCCTGAACGCGTTCTCCTTCGACCCCTCCCTCTGCTCCGCCGCCGTCGCCGACCTCCGCGCCGCCCGCGAACGCGACCCCGCCTGCGTTTCCTACTCCCACTGCCTCCTCAATTACAAAGGCTTCCTCGCTTGCCAGGCGCACCGTGTGGCGCATCTGTTGTGGCGGCAATCGCGGCAGCCATTGGCTTTAGCACTGCACTCTCGCATCGCTGATGTGTTCGCGGTGGACATTCACCCTGCGGCGAGGATCGGGAAGGGGATTCTGTTCGACCATGCCACCGGGGTGGTGGTGGGGGAGACGGCAGTGATCGGGAACAATGTGTCGATCCTGCACCACGTTACGCTGGGTGGGACTGGCAAGGTTGGTGGGGACCGGCATCCCAAGATTGGGGATGGGGTGCTTATTGGTGCCGGTGCTACCATTCTGGGGAATATTAAGATCGGGGAAGGTGCAAAGGTTGGTGCTGGCTCGGTGGTTTTAATCGATGTGCCACCACAGACAACAGCTGTTGGGAACCCAGCCAGGTTGGTTGGTGGGAAGGAGAAGCCCTCTAAGCACGAGGATGTTCCTGGGGAGTCCATGGACCATACTTCCTTTATCTCTGAGTGGTCAGATTATATCATTTGA

>Glyma07g06480.1   sequence type=predicted peptide   gene model=Glyma07g06480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPTGLPKANSSVAPDDQGWLWTQIKAEARRDAELEPALASYLYSTILSHSSLVRSLSFHLGNKLCSSTLLSTLLYDLFLNAFSFDPSLCSAAVADLRAARERDPACVSYSHCLLNYKGFLACQAHRVAHLLWRQSRQPLALALHSRIADVFAVDIHPAARIGKGILFDHATGVVVGETAVIGNNVSILHHVTLGGTGKVGGDRHPKIGDGVLIGAGATILGNIKIGEGAKVGAGSVVLIDVPPQTTAVGNPARLVGGKEKPSKHEDVPGESMDHTSFISEWSDYII*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo